Transcript: Human NM_001283022.2

Homo sapiens guanosine monophosphate reductase 2 (GMPR2), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
GMPR2 (51292)
Length:
2019
CDS:
272..1555

Additional Resources:

NCBI RefSeq record:
NM_001283022.2
NBCI Gene record:
GMPR2 (51292)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001283022.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000293788 TAAGCGCCATGCCTCATATTG pLKO_005 318 CDS 100% 13.200 18.480 N GMPR2 n/a
2 TRCN0000039010 GTTCCCATCATTGCTGCCAAT pLKO.1 467 CDS 100% 4.050 5.670 N GMPR2 n/a
3 TRCN0000293787 CAACATCCTGAAGATTATTAA pLKO_005 1818 3UTR 100% 15.000 10.500 N GMPR2 n/a
4 TRCN0000039012 CTGCTGTCCATAAGCACTATA pLKO.1 546 CDS 100% 13.200 9.240 N GMPR2 n/a
5 TRCN0000286351 CTGCTGTCCATAAGCACTATA pLKO_005 546 CDS 100% 13.200 9.240 N GMPR2 n/a
6 TRCN0000039011 GAGCAGGAGAACTACCTTCAT pLKO.1 1489 CDS 100% 4.950 3.465 N GMPR2 n/a
7 TRCN0000298189 GAGCAGGAGAACTACCTTCAT pLKO_005 1489 CDS 100% 4.950 3.465 N GMPR2 n/a
8 TRCN0000039013 ACATCATTTCAGATGGAGGTT pLKO.1 969 CDS 100% 2.640 1.848 N GMPR2 n/a
9 TRCN0000039009 CTATGGAATGAGTTCTGAAAT pLKO.1 1123 CDS 100% 13.200 7.920 N GMPR2 n/a
10 TRCN0000286350 CTATGGAATGAGTTCTGAAAT pLKO_005 1123 CDS 100% 13.200 7.920 N GMPR2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001283022.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11971 pDONR223 100% 95.7% 95.7% None 1_54del n/a
2 ccsbBroad304_11971 pLX_304 0% 95.7% 95.7% V5 1_54del n/a
3 TRCN0000471192 GGACTCGGTATCTAAATAAGCCCC pLX_317 33.5% 95.7% 95.7% V5 1_54del n/a
4 ccsbBroadEn_03268 pDONR223 100% 81.4% 81.4% None 1_54del;910_1092del n/a
5 ccsbBroad304_03268 pLX_304 0% 81.4% 81.4% V5 1_54del;910_1092del n/a
6 TRCN0000478673 CTCGAATAAAATTCAGAGCCAGTG pLX_317 33.8% 81.4% 81.4% V5 1_54del;910_1092del n/a
Download CSV