Transcript: Mouse NM_001283045.1

Mus musculus c-abl oncogene 1, non-receptor tyrosine kinase (Abl1), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Abl1 (11350)
Length:
6039
CDS:
220..3576

Additional Resources:

NCBI RefSeq record:
NM_001283045.1
NBCI Gene record:
Abl1 (11350)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001283045.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000023355 GCAGTTTGACTCATCCACCTT pLKO.1 2436 CDS 100% 2.640 3.696 N Abl1 n/a
2 TRCN0000321819 CAGGGCTCTTGTGCCTATAAA pLKO_005 3616 3UTR 100% 15.000 12.000 N Abl1 n/a
3 TRCN0000321753 CTCCGGGTCTTGGGTTATAAT pLKO_005 466 CDS 100% 15.000 12.000 N Abl1 n/a
4 TRCN0000023356 GTACACTTTCTGTGTGAGCTA pLKO.1 3372 CDS 100% 2.640 2.112 N Abl1 n/a
5 TRCN0000023354 CGTGTGGGCATTTGGAGTATT pLKO.1 1467 CDS 100% 13.200 9.240 N Abl1 n/a
6 TRCN0000321817 CGTGTGGGCATTTGGAGTATT pLKO_005 1467 CDS 100% 13.200 9.240 N Abl1 n/a
7 TRCN0000374364 GGAAGGAAGCTGTCGCTTTAA pLKO_005 4059 3UTR 100% 13.200 9.240 N Abl1 n/a
8 TRCN0000023358 CGAGGGCGTTTGGAAGAAGTA pLKO.1 975 CDS 100% 4.950 3.465 N Abl1 n/a
9 TRCN0000321816 CGAGGGCGTTTGGAAGAAGTA pLKO_005 975 CDS 100% 4.950 3.465 N Abl1 n/a
10 TRCN0000023357 AGACAGAAAGACCAACCTGTT pLKO.1 1983 CDS 100% 4.050 2.835 N Abl1 n/a
11 TRCN0000039900 GCTGAAATCCACCAAGCCTTT pLKO.1 1663 CDS 100% 4.050 2.835 N ABL1 n/a
12 TRCN0000332951 GCTGAAATCCACCAAGCCTTT pLKO_005 1663 CDS 100% 4.050 2.835 N ABL1 n/a
13 TRCN0000121098 CCAGTGGAGATAACACTCTAA pLKO.1 425 CDS 100% 4.950 3.465 N ABL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001283045.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14525 pDONR223 0% 83.1% 84.8% None (many diffs) n/a
2 ccsbBroad304_14525 pLX_304 0% 83.1% 84.8% V5 (many diffs) n/a
3 TRCN0000474000 CGACTCCTGGAGTTTTTCATCTAT pLX_317 13.2% 83% 84.8% V5 (many diffs) n/a
4 TRCN0000491940 CAGCACAACACGTATGAATTGTCG pLX_317 9.5% 83% 84.7% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000489115 CTGGTATAGCACCAATTGGAATTC pLX_317 10.2% 83% 84.7% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000489646 CCAGTCTGCGTCTGTTACGCTGCG pLX_317 12% 83% 84.7% V5 (not translated due to prior stop codon) (many diffs) n/a
7 TRCN0000488091 GTGAACTGATCCAACGTAAGCTCG pLX_317 10.2% 83% 84.7% V5 (not translated due to prior stop codon) (many diffs) n/a
8 TRCN0000489555 TTAGATTATTATAAGACCCGGGCC pLX_317 11.6% 83% 84.7% V5 (not translated due to prior stop codon) (many diffs) n/a
9 TRCN0000489612 CGATTCCTAACACCTTCTAACGTC pLX_317 12% 83% 84.7% V5 (not translated due to prior stop codon) (many diffs) n/a
10 TRCN0000487758 ACTTAAACCATCCTAGGAACAGTC pLX_317 8.6% 83% 84.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV