Transcript: Human NM_001286071.1

Homo sapiens chromosome 11 open reading frame 54 (C11orf54), transcript variant 6, mRNA.

Source:
NCBI, updated 2018-10-09
Taxon:
Homo sapiens (human)
Gene:
C11orf54 (28970)
Length:
2417
CDS:
233..1003

Additional Resources:

NCBI RefSeq record:
NM_001286071.1
NBCI Gene record:
C11orf54 (28970)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001286071.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000167701 GATTTGACTAAGGAACCCTTT pLKO.1 350 CDS 100% 4.050 5.670 N C11orf54 n/a
2 TRCN0000168417 GCAGAGTTTCTCTATCGCATT pLKO.1 944 CDS 100% 4.050 5.670 N C11orf54 n/a
3 TRCN0000426035 GCTTGCTGGAGTTATGCAGAA pLKO_005 277 CDS 100% 4.050 5.670 N C11orf54 n/a
4 TRCN0000167732 GCGAAATCAGTCATGTTTATA pLKO.1 1419 3UTR 100% 15.000 12.000 N C11orf54 n/a
5 TRCN0000168322 GCATTCAATTGGGCGAGATTA pLKO.1 982 CDS 100% 13.200 10.560 N C11orf54 n/a
6 TRCN0000418258 CTCACTACTTAAATCCCATTT pLKO_005 1250 3UTR 100% 10.800 8.640 N C11orf54 n/a
7 TRCN0000167174 CCTTACTTATTGCCTCTTGTA pLKO.1 428 CDS 100% 4.950 3.960 N C11orf54 n/a
8 TRCN0000167175 CCAGATATAGTGGAATATCTT pLKO.1 908 CDS 100% 0.563 0.450 N C11orf54 n/a
9 TRCN0000414099 ATCAGGAATCATGCAATTATT pLKO_005 1454 3UTR 100% 15.000 10.500 N C11orf54 n/a
10 TRCN0000429977 CAGAGACCCAGGGTTTGATTT pLKO_005 820 CDS 100% 13.200 9.240 N C11orf54 n/a
11 TRCN0000168616 GAAGGTGGACACTACCATTAT pLKO.1 878 CDS 100% 13.200 9.240 N C11orf54 n/a
12 TRCN0000412718 ATTTGACTAAGGAACCCTTTA pLKO_005 351 CDS 100% 10.800 7.560 N C11orf54 n/a
13 TRCN0000424180 CCCTTGAACTCTGATGAAGAA pLKO_005 734 CDS 100% 4.950 3.465 N C11orf54 n/a
14 TRCN0000178173 GTGCCTTACTTATTGCCTCTT pLKO.1 425 CDS 100% 4.050 2.430 N 4931406C07Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286071.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03048 pDONR223 100% 87.6% 77.8% None (many diffs) n/a
2 ccsbBroad304_03048 pLX_304 0% 87.6% 77.8% V5 (many diffs) n/a
3 TRCN0000473941 AACTTGGAATTAACTTCTTAAGCA pLX_317 47.2% 87.6% 77.8% V5 (many diffs) n/a
4 ccsbBroadEn_15800 pDONR223 0% 71.3% 60.4% None (many diffs) n/a
5 ccsbBroad304_15800 pLX_304 0% 71.3% 60.4% V5 (many diffs) n/a
6 TRCN0000473226 AATGTATGCTGCCCCACGAAGGTG pLX_317 84% 71.3% 60.4% V5 (many diffs) n/a
Download CSV