Transcript: Mouse NM_001286759.1

Mus musculus RAP1, GTP-GDP dissociation stimulator 1 (Rap1gds1), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Rap1gds1 (229877)
Length:
3671
CDS:
163..1983

Additional Resources:

NCBI RefSeq record:
NM_001286759.1
NBCI Gene record:
Rap1gds1 (229877)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001286759.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105791 CCAGGAACGATGGAAATTGTA pLKO.1 1193 CDS 100% 5.625 4.500 N Rap1gds1 n/a
2 TRCN0000105790 CCTGCCTAATAAGATTTCTAA pLKO.1 2129 3UTR 100% 5.625 4.500 N Rap1gds1 n/a
3 TRCN0000029791 GCAGAACTTGAGTCAAGTAAA pLKO.1 790 CDS 100% 13.200 9.240 N RAP1GDS1 n/a
4 TRCN0000344335 GCAGAACTTGAGTCAAGTAAA pLKO_005 790 CDS 100% 13.200 9.240 N RAP1GDS1 n/a
5 TRCN0000105793 CTCAGAATAATGCAGAAACAA pLKO.1 266 CDS 100% 5.625 3.938 N Rap1gds1 n/a
6 TRCN0000105792 CGTTTGGTTGAATGGTGTGAA pLKO.1 1504 CDS 100% 4.950 3.465 N Rap1gds1 n/a
7 TRCN0000105794 CATGTAATCATGCAGAATGAA pLKO.1 1666 CDS 100% 5.625 3.375 N Rap1gds1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286759.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15560 pDONR223 0% 89% 95% None (many diffs) n/a
2 ccsbBroad304_15560 pLX_304 0% 89% 95% V5 (many diffs) n/a
3 TRCN0000473828 ACCTTAGATAAAGTTGCTTTGGAC pLX_317 31.2% 89% 95% V5 (many diffs) n/a
4 ccsbBroadEn_06840 pDONR223 100% 88.8% 94.7% None (many diffs) n/a
5 ccsbBroad304_06840 pLX_304 0% 88.8% 94.7% V5 (many diffs) n/a
6 TRCN0000472959 AGAGCGGCCACCCTCAACTTCTCT pLX_317 5.6% 88.8% 94.7% V5 (many diffs) n/a
Download CSV