Transcript: Human NM_001287137.1

Homo sapiens cyclin dependent kinase 14 (CDK14), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
CDK14 (5218)
Length:
4804
CDS:
312..1334

Additional Resources:

NCBI RefSeq record:
NM_001287137.1
NBCI Gene record:
CDK14 (5218)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001148240 ACCTTCTGATCAGTGACACG pXPR_003 GGG 411 40% 6 0.4488 CDK14 CDK14 76640
2 BRDN0001146521 AAGAGTCACCTAAAGTTAGG pXPR_003 CGG 53 5% 2 0.2274 CDK14 CDK14 76639
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001287137.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195204 CCCTAGGTTATGCGTCTATAT pLKO.1 4176 3UTR 100% 13.200 18.480 N CDK14 n/a
2 TRCN0000002370 CCACCCATACAGGAAATCCAA pLKO.1 3562 3UTR 100% 3.000 4.200 N CDK14 n/a
3 TRCN0000196349 GCTGCATAATTGCGCATAACT pLKO.1 4306 3UTR 100% 5.625 4.500 N CDK14 n/a
4 TRCN0000321940 TTACATCCACCAGCGTTATAT pLKO_005 659 CDS 100% 15.000 10.500 N Cdk14 n/a
5 TRCN0000196525 GAGAACAATGCTTGCATTAAC pLKO.1 305 5UTR 100% 13.200 9.240 N CDK14 n/a
6 TRCN0000196833 GAACGAATATTTCTGGTTCTT pLKO.1 951 CDS 100% 4.950 3.465 N CDK14 n/a
7 TRCN0000002366 GAGTTCATTCTTTACCACATT pLKO.1 1000 CDS 100% 4.950 3.465 N CDK14 n/a
8 TRCN0000002369 GTAGGTTGCATCTTTGTTGAA pLKO.1 876 CDS 100% 4.950 3.465 N CDK14 n/a
9 TRCN0000195148 CAAAGATGTCTACACGGAACT pLKO.1 153 5UTR 100% 4.050 2.835 N CDK14 n/a
10 TRCN0000023240 GCACACTGATTTATGTCAGTA pLKO.1 563 CDS 100% 0.495 0.347 N Cdk14 n/a
11 TRCN0000002367 GCAAAGAGTCACCTAAAGTTA pLKO.1 345 CDS 100% 5.625 3.375 N CDK14 n/a
12 TRCN0000194977 CATGACATCATCCATACCAAG pLKO.1 513 CDS 100% 4.050 2.430 N CDK14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001287137.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491739 ATTAAAAGAGAAATATGCATACGC pLX_317 27.6% 75.3% 71.3% V5 (not translated due to prior stop codon) 0_1ins238;77_78ins95 n/a
2 ccsbBroadEn_14748 pDONR223 100% 74.8% 70.5% None (many diffs) n/a
3 ccsbBroad304_14748 pLX_304 0% 74.8% 70.5% V5 (many diffs) n/a
Download CSV