Transcript: Human NM_001288642.2

Homo sapiens zinc finger protein 286A (ZNF286A), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-04-09
Taxon:
Homo sapiens (human)
Gene:
ZNF286A (57335)
Length:
5211
CDS:
20..1714

Additional Resources:

NCBI RefSeq record:
NM_001288642.2
NBCI Gene record:
ZNF286A (57335)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001288642.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000271313 TTTCGTAATACCGTCAGTTAA pLKO_005 4087 3UTR 100% 13.200 18.480 N ZNF286A n/a
2 TRCN0000271315 GAAGCTGGATCCTGCACAAAG pLKO_005 328 CDS 100% 10.800 7.560 N ZNF286A n/a
3 TRCN0000271312 TAGGAACCTAGTCTCACTTTG pLKO_005 370 CDS 100% 10.800 7.560 N ZNF286A n/a
4 TRCN0000015154 GAGAGCTACAACTTGGAGAAT pLKO.1 410 CDS 100% 4.950 3.465 N ZNF286A n/a
5 TRCN0000015157 GCAGCTATTCAGACATGGAGA pLKO.1 471 CDS 100% 2.640 1.848 N ZNF286A n/a
6 TRCN0000271316 GATGTGGCCATGGACTTTACA pLKO_005 293 CDS 100% 5.625 3.375 N ZNF286A n/a
7 TRCN0000271314 ACCATTGAAGCTTGAGAGAAA pLKO_005 439 CDS 100% 4.950 2.970 N ZNF286A n/a
8 TRCN0000015156 CATTCATTCATCAGCTCTCAT pLKO.1 1573 CDS 100% 4.950 2.970 N ZNF286A n/a
9 TRCN0000235273 ACTGGAGAGAAACCTTATAAA pLKO_005 1277 CDS 100% 15.000 7.500 Y Gm10771 n/a
10 TRCN0000337271 ACTGGAGAGAAACCTTATAAA pLKO_005 1277 CDS 100% 15.000 7.500 Y ZNF286B n/a
11 TRCN0000350860 GGTTCTTTATGTCCGTTAATT pLKO_005 1870 3UTR 100% 15.000 7.500 Y ZNF286B n/a
12 TRCN0000337317 ACGTTGGAGAGAGACCTTATG pLKO_005 1107 CDS 100% 10.800 5.400 Y ZNF286B n/a
13 TRCN0000015155 GCCACAGAGCTAATTTAACTA pLKO.1 990 CDS 100% 5.625 2.813 Y ZNF286A n/a
14 TRCN0000015153 GCAGAGAACTTATAAAGAGAA pLKO.1 847 CDS 100% 4.950 2.475 Y ZNF286A n/a
15 TRCN0000148104 GAGTGTAATGAATGTGGGAAA pLKO.1 1463 CDS 100% 4.050 2.025 Y ZNF658B n/a
16 TRCN0000172742 GAGACAGAGTCTTGCTCTGTT pLKO.1 2376 3UTR 100% 0.495 0.248 Y C11orf44 n/a
17 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2616 3UTR 100% 5.625 2.813 Y KLHL30 n/a
18 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 2482 3UTR 100% 2.640 1.320 Y LINC01098 n/a
19 TRCN0000218427 ACTGGAGAGAAACCCTATAAA pLKO_005 944 CDS 100% 15.000 7.500 Y ZNF443 n/a
20 TRCN0000374174 ACTGGAGAGAAACCCTATAAA pLKO_005 944 CDS 100% 15.000 7.500 Y Zfp97 n/a
21 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2616 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001288642.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12340 pDONR223 100% 72.5% 72.5% None 1_465del n/a
2 ccsbBroad304_12340 pLX_304 0% 72.5% 72.5% V5 1_465del n/a
3 TRCN0000480946 CGGGCTCAATCCGAGCGGCAACGA pLX_317 30% 72.5% 72.5% V5 1_465del n/a
Download CSV