Transcript: Human NM_001288964.2

Homo sapiens centrosomal protein 70 (CEP70), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
CEP70 (80321)
Length:
2618
CDS:
208..1947

Additional Resources:

NCBI RefSeq record:
NM_001288964.2
NBCI Gene record:
CEP70 (80321)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001288964.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415299 TTCATACACAAAGGCAATATA pLKO_005 833 CDS 100% 15.000 21.000 N CEP70 n/a
2 TRCN0000141646 CAACGAGCTAATGACTTGGAA pLKO.1 481 CDS 100% 3.000 4.200 N CEP70 n/a
3 TRCN0000434676 TAGTTGCAAGGGTAAGGTAAT pLKO_005 2132 3UTR 100% 10.800 8.640 N CEP70 n/a
4 TRCN0000431645 TCAAATTACAGGAGCTTATTA pLKO_005 1094 CDS 100% 15.000 10.500 N CEP70 n/a
5 TRCN0000121915 CAGGAGCTTATAGAAACTAAT pLKO.1 406 CDS 100% 13.200 9.240 N CEP70 n/a
6 TRCN0000142362 GAGCAGGTTATGCAGGTATTA pLKO.1 1765 CDS 100% 13.200 9.240 N CEP70 n/a
7 TRCN0000144592 GAACATGATACAGGAGCTTAT pLKO.1 396 CDS 100% 10.800 7.560 N CEP70 n/a
8 TRCN0000422712 GGTGCTGTGTAGCATCAATTC pLKO_005 1203 CDS 100% 10.800 7.560 N CEP70 n/a
9 TRCN0000423281 TAATTGACCAGAGATACTTTC pLKO_005 1181 CDS 100% 10.800 7.560 N CEP70 n/a
10 TRCN0000142363 GAACGGAGCAAGAAGAAACTA pLKO.1 647 CDS 100% 5.625 3.938 N CEP70 n/a
11 TRCN0000141989 GACAGCAATATGCCACACTTT pLKO.1 1522 CDS 100% 4.950 3.465 N CEP70 n/a
12 TRCN0000121863 GCAGATCAACTGACATCCTTA pLKO.1 1351 CDS 100% 4.950 3.465 N CEP70 n/a
13 TRCN0000145474 GCCTTCTTTAAATGGAGTCTA pLKO.1 1590 CDS 100% 4.950 3.465 N CEP70 n/a
14 TRCN0000141829 GCTAGTAAGCACTGTTGGAAA pLKO.1 1713 CDS 100% 4.950 3.465 N CEP70 n/a
15 TRCN0000141119 CCAATCAAGAACAACGAGCTA pLKO.1 470 CDS 100% 2.640 1.848 N CEP70 n/a
16 TRCN0000145182 GCTTAATTTGAAGAAGCAGGA pLKO.1 1422 CDS 100% 2.160 1.512 N CEP70 n/a
17 TRCN0000422492 ATTGATGATGCATGGCTTAAA pLKO_005 258 CDS 100% 13.200 7.920 N CEP70 n/a
18 TRCN0000142143 GAAGATGTGAATGAGCAGGTT pLKO.1 1753 CDS 100% 2.640 1.584 N CEP70 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001288964.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09028 pDONR223 100% 96.8% 95.6% None (many diffs) n/a
2 ccsbBroad304_09028 pLX_304 0% 96.8% 95.6% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000467975 AAATTTTCATGCAATATTGAGCCA pLX_317 23.2% 96.8% 95.6% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_12693 pDONR223 100% 32.4% 32.3% None 0_1ins54;350G>A;583_1737del n/a
5 ccsbBroad304_12693 pLX_304 0% 32.4% 32.3% V5 0_1ins54;350G>A;583_1737del n/a
6 TRCN0000473965 TCACACCATTCCACAGGCAGCGCA pLX_317 92.2% 32.4% 32.3% V5 0_1ins54;350G>A;583_1737del n/a
Download CSV