Transcript: Human NM_001289088.1

Homo sapiens zinc finger MYM-type containing 1 (ZMYM1), transcript variant 1, mRNA.

Source:
NCBI, updated 2018-06-30
Taxon:
Homo sapiens (human)
Gene:
ZMYM1 (79830)
Length:
4509
CDS:
441..3869

Additional Resources:

NCBI RefSeq record:
NM_001289088.1
NBCI Gene record:
ZMYM1 (79830)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001289088.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000015418 CGCCGATGAATTGAGTCATTT pLKO.1 2966 CDS 100% 13.200 18.480 N ZMYM1 n/a
2 TRCN0000329993 CGCCGATGAATTGAGTCATTT pLKO_005 2966 CDS 100% 13.200 18.480 N ZMYM1 n/a
3 TRCN0000015422 CGTACATTACTATCTGTGATT pLKO.1 2880 CDS 100% 4.950 6.930 N ZMYM1 n/a
4 TRCN0000015419 CCACGGAACTTCTAATTGGAA pLKO.1 1931 CDS 100% 3.000 4.200 N ZMYM1 n/a
5 TRCN0000329994 TCTTGATTCTTGGTCTATAAT pLKO_005 4149 3UTR 100% 15.000 12.000 N ZMYM1 n/a
6 TRCN0000330026 CCAAGGATTAGATACTATATT pLKO_005 3347 CDS 100% 15.000 10.500 N ZMYM1 n/a
7 TRCN0000329995 CTATGATAGCACCACTAATTT pLKO_005 2585 CDS 100% 15.000 10.500 N ZMYM1 n/a
8 TRCN0000353584 GAGCTGTCAGTGACGATTTAT pLKO_005 2041 CDS 100% 15.000 10.500 N ZMYM1 n/a
9 TRCN0000015420 GCAGCAAATTGGAGTTGATAT pLKO.1 2543 CDS 100% 13.200 9.240 N ZMYM1 n/a
10 TRCN0000015421 GCAGATGTCATTGTGGATCTT pLKO.1 1569 CDS 100% 4.950 3.465 N ZMYM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001289088.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12627 pDONR223 100% 78.9% 78.7% None 2696_2697insT;2706_3426del n/a
2 ccsbBroad304_12627 pLX_304 0% 78.9% 78.7% V5 2696_2697insT;2706_3426del n/a
3 TRCN0000465725 ATCCGGATAACGGGAAGACTTAAT pLX_317 1.8% 78.9% 78.7% V5 2696_2697insT;2706_3426del n/a
Download CSV