Transcript: Human NM_001289121.1

Homo sapiens zinc finger CCHC-type containing 7 (ZCCHC7), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-02-24
Taxon:
Homo sapiens (human)
Gene:
ZCCHC7 (84186)
Length:
2846
CDS:
319..1950

Additional Resources:

NCBI RefSeq record:
NM_001289121.1
NBCI Gene record:
ZCCHC7 (84186)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001289121.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419048 ATATCCATGGAGATCTCAATT pLKO_005 2098 3UTR 100% 13.200 18.480 N ZCCHC7 n/a
2 TRCN0000428433 TCCGAGAGGTCATGATTATAG pLKO_005 764 CDS 100% 13.200 18.480 N ZCCHC7 n/a
3 TRCN0000412979 ATTCGGAATCTTCGAGTAGTA pLKO_005 500 CDS 100% 4.950 6.930 N ZCCHC7 n/a
4 TRCN0000033993 CAATCTAATGAGCTGGTTGAT pLKO.1 688 CDS 100% 4.950 6.930 N ZCCHC7 n/a
5 TRCN0000033991 CGAGATGAGTCATCTAGTGAA pLKO.1 370 CDS 100% 4.950 6.930 N ZCCHC7 n/a
6 TRCN0000033989 GCGGTACTATTCAGCCAACAA pLKO.1 1014 CDS 100% 4.950 6.930 N ZCCHC7 n/a
7 TRCN0000033992 GTCTCCAGTATCTCCATTCAT pLKO.1 1431 CDS 100% 5.625 4.500 N ZCCHC7 n/a
8 TRCN0000414420 ATATTGAGAAGCCTAAATCTG pLKO_005 725 CDS 100% 4.950 3.960 N ZCCHC7 n/a
9 TRCN0000417576 AGATAGCTAATAACCGAACAC pLKO_005 977 CDS 100% 4.050 3.240 N ZCCHC7 n/a
10 TRCN0000421935 TACTTTGGAAAGGACAATAAC pLKO_005 2373 3UTR 100% 13.200 9.240 N ZCCHC7 n/a
11 TRCN0000432864 AGAAGCCTTCTAAGCCCTTTC pLKO_005 1784 CDS 100% 6.000 4.200 N ZCCHC7 n/a
12 TRCN0000033990 CCACACGTCAAGAGAAGACAA pLKO.1 1821 CDS 100% 4.950 3.465 N ZCCHC7 n/a
13 TRCN0000429041 GAGGTCATCACTTTGTCTGAT pLKO_005 586 CDS 100% 4.950 3.465 N ZCCHC7 n/a
14 TRCN0000418762 GGCCATTATGGACACGAATGT pLKO_005 1387 CDS 100% 4.950 3.465 N ZCCHC7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001289121.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10214 pDONR223 100% 99.8% 99.8% None 1_3delATG n/a
2 ccsbBroad304_10214 pLX_304 0% 99.8% 99.8% V5 1_3delATG n/a
3 TRCN0000469258 CCCTGCAGGCCGTATCTATACCTG pLX_317 24.9% 99.8% 99.8% V5 1_3delATG n/a
4 ccsbBroadEn_12789 pDONR223 100% 57.2% 42.6% None 223A>G;692delC;935_1629del n/a
5 ccsbBroad304_12789 pLX_304 0% 57.2% 42.6% V5 223A>G;692delC;935_1629del n/a
6 TRCN0000472866 AGCCTCCCCAACCATTTCCGTCCC pLX_317 20.9% 57.2% 42.6% V5 223A>G;692delC;935_1629del n/a
7 ccsbBroadEn_16029 pDONR223 0% 37.6% 37.3% None 193T>C;611_612insCCA;616_1629del n/a
8 ccsbBroad304_16029 pLX_304 0% 37.6% 37.3% V5 193T>C;611_612insCCA;616_1629del n/a
9 TRCN0000474870 GTTACCACAAGAGTTATCGGATAC pLX_317 51.5% 37.6% 37.3% V5 193T>C;611_612insCCA;616_1629del n/a
Download CSV