Transcript: Mouse NM_001289458.1

Mus musculus hepatocyte growth factor (Hgf), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Hgf (15234)
Length:
2838
CDS:
206..2392

Additional Resources:

NCBI RefSeq record:
NM_001289458.1
NBCI Gene record:
Hgf (15234)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001289458.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000336133 CTTCGAGCTATCGCGGTAAAG pLKO_005 699 CDS 100% 10.800 15.120 N Hgf n/a
2 TRCN0000031280 GCAGCTATAAAGGGACGGTAT pLKO.1 609 CDS 100% 4.050 5.670 N Hgf n/a
3 TRCN0000336131 GGTAAAGGAGGCAGCTATAAA pLKO_005 599 CDS 100% 15.000 10.500 N Hgf n/a
4 TRCN0000336193 CCTGCAAGTGCAGTAACATAT pLKO_005 2596 3UTR 100% 13.200 9.240 N Hgf n/a
5 TRCN0000336132 GAAGCGCAAGCAGATCTTAAA pLKO_005 1891 CDS 100% 13.200 9.240 N Hgf n/a
6 TRCN0000336190 TTGGGATTATTGCCCTATTTC pLKO_005 1588 CDS 100% 13.200 9.240 N Hgf n/a
7 TRCN0000031279 CCTGAAGATACTTGAATGAAT pLKO.1 2619 3UTR 100% 5.625 3.938 N Hgf n/a
8 TRCN0000031281 GCCAGAAACAAAGACTTGAAA pLKO.1 1820 CDS 100% 5.625 3.938 N Hgf n/a
9 TRCN0000031282 CCCTGGTGTTTCACAAGCAAT pLKO.1 767 CDS 100% 4.950 3.465 N Hgf n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001289458.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000476979 GGAATTTGTCACGGTGGCAGCATC pLX_317 19.7% 87.6% 89.8% V5 (many diffs) n/a
2 ccsbBroadEn_15441 pDONR223 0% 34.9% 35.3% None (many diffs) n/a
3 ccsbBroad304_15441 pLX_304 0% 34.9% 35.3% V5 (many diffs) n/a
4 TRCN0000474052 ACATACCTGGAATATGGGTGGTCG pLX_317 36.5% 34.9% 35.3% V5 (many diffs) n/a
5 ccsbBroadEn_06362 pDONR223 100% 25.4% 25.5% None (many diffs) n/a
6 ccsbBroad304_06362 pLX_304 0% 25.4% 25.5% V5 (many diffs) n/a
7 TRCN0000465581 GAGGAACTTTTGAAGCTGCAGCAA pLX_317 33.8% 25.4% 25.5% V5 (many diffs) n/a
Download CSV