Transcript: Mouse NM_001289479.1

Mus musculus 3'-phosphoadenosine 5'-phosphosulfate synthase 1 (Papss1), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Papss1 (23971)
Length:
2905
CDS:
652..2319

Additional Resources:

NCBI RefSeq record:
NM_001289479.1
NBCI Gene record:
Papss1 (23971)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001289479.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000024505 GCAACCAACGTCACCTATCAA pLKO.1 406 5UTR 100% 5.625 7.875 N Papss1 n/a
2 TRCN0000024508 CATCAACTTATCGGTGCCTAT pLKO.1 1347 CDS 100% 4.050 5.670 N Papss1 n/a
3 TRCN0000274668 CATCAACTTATCGGTGCCTAT pLKO_005 1347 CDS 100% 4.050 5.670 N Papss1 n/a
4 TRCN0000274667 CATCCGCCAAGGACTCAATAA pLKO_005 714 CDS 100% 13.200 10.560 N Papss1 n/a
5 TRCN0000374386 GACAGCTACGCACGAGGATAA pLKO_005 1374 CDS 100% 10.800 8.640 N Papss1 n/a
6 TRCN0000024504 CCACGAAGACTTCGAGTTTAT pLKO.1 2181 CDS 100% 13.200 9.240 N Papss1 n/a
7 TRCN0000274611 CCACGAAGACTTCGAGTTTAT pLKO_005 2181 CDS 100% 13.200 9.240 N Papss1 n/a
8 TRCN0000323482 TATGCTTCTGTCTTACAATTT pLKO_005 2584 3UTR 100% 13.200 9.240 N Papss1 n/a
9 TRCN0000024506 GACCGGATTTACTGGAATGAT pLKO.1 1597 CDS 100% 5.625 3.938 N Papss1 n/a
10 TRCN0000274610 GACCGGATTTACTGGAATGAT pLKO_005 1597 CDS 100% 5.625 3.938 N Papss1 n/a
11 TRCN0000024507 CACCAGCTTTATATCGCCTTA pLKO.1 828 CDS 100% 4.050 2.835 N Papss1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001289479.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14011 pDONR223 100% 80.5% 90.7% None (many diffs) n/a
2 ccsbBroad304_14011 pLX_304 0% 80.5% 90.7% V5 (many diffs) n/a
3 TRCN0000465760 CCATCGCCATTCATCGTGCCCCGC pLX_317 22.2% 80.5% 90.7% V5 (many diffs) n/a
4 ccsbBroadEn_14925 pDONR223 0% 80.5% 90.7% None (many diffs) n/a
5 ccsbBroad304_14925 pLX_304 0% 80.5% 90.7% V5 (many diffs) n/a
6 TRCN0000466779 ATTAGCAGGAAGAAATATGTGGTT pLX_317 22.2% 80.4% 90.5% V5 (many diffs) n/a
7 TRCN0000491740 GACTTCGACTGTCGATACGGATGT pLX_317 23.8% 80.5% 90.7% V5 (not translated due to prior stop codon) (many diffs) n/a
8 TRCN0000487874 CAACTGTATAAGAGCGAGAACATC pLX_317 16.3% 80.5% 90.5% V5 (many diffs) n/a
9 ccsbBroadEn_07352 pDONR223 100% 77.8% 87.6% None (many diffs) n/a
10 ccsbBroad304_07352 pLX_304 0% 77.8% 87.6% V5 (many diffs) n/a
11 TRCN0000469199 ATGTTAACCCTACTTTGCTGTCTT pLX_317 22.9% 77.8% 87.6% V5 (many diffs) n/a
Download CSV