Transcript: Mouse NM_001289517.1

Mus musculus anaphase-promoting complex subunit 5 (Anapc5), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Anapc5 (59008)
Length:
2727
CDS:
193..2352

Additional Resources:

NCBI RefSeq record:
NM_001289517.1
NBCI Gene record:
Anapc5 (59008)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001289517.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000087995 GCACTGTTTGAGCTGGCTTTA pLKO.1 1170 CDS 100% 10.800 15.120 N Gm10482 n/a
2 TRCN0000088405 GCCGCTTTGTTGAAGAATGAT pLKO.1 805 CDS 100% 5.625 7.875 N Anapc5 n/a
3 TRCN0000325253 GCCGCTTTGTTGAAGAATGAT pLKO_005 805 CDS 100% 5.625 7.875 N Anapc5 n/a
4 TRCN0000088407 CTGAAGGATATGGAACAATTT pLKO.1 469 CDS 100% 13.200 9.240 N Anapc5 n/a
5 TRCN0000325252 CTGAAGGATATGGAACAATTT pLKO_005 469 CDS 100% 13.200 9.240 N Anapc5 n/a
6 TRCN0000088406 GCTCATTACCTCAGCTACTTA pLKO.1 904 CDS 100% 5.625 3.938 N Anapc5 n/a
7 TRCN0000325255 GCTCATTACCTCAGCTACTTA pLKO_005 904 CDS 100% 5.625 3.938 N Anapc5 n/a
8 TRCN0000087932 CAGAACAATACTGAGTCCTTT pLKO.1 1486 CDS 100% 4.950 3.465 N Gm5288 n/a
9 TRCN0000088404 GCCCAGATATTACACTGTCAA pLKO.1 365 CDS 100% 4.950 3.465 N Anapc5 n/a
10 TRCN0000325254 GCCCAGATATTACACTGTCAA pLKO_005 365 CDS 100% 4.950 3.465 N Anapc5 n/a
11 TRCN0000088403 GCCAAGAACTACTTTGCACAA pLKO.1 2173 CDS 100% 4.050 2.835 N Anapc5 n/a
12 TRCN0000325251 GCCAAGAACTACTTTGCACAA pLKO_005 2173 CDS 100% 4.050 2.835 N Anapc5 n/a
13 TRCN0000004155 GCAATGAATGATGGCAAATAT pLKO.1 1663 CDS 100% 15.000 10.500 N ANAPC5 n/a
14 TRCN0000277760 GCAATGAATGATGGCAAATAT pLKO_005 1663 CDS 100% 15.000 10.500 N ANAPC5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001289517.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03305 pDONR223 100% 85.6% 90% None (many diffs) n/a
2 ccsbBroad304_03305 pLX_304 0% 85.6% 90% V5 (many diffs) n/a
3 TRCN0000470872 ATTGACGTCAGGCGACGCTCCCAT pLX_317 18.2% 85.6% 90% V5 (many diffs) n/a
4 ccsbBroadEn_15839 pDONR223 0% 85.6% 90% None (many diffs) n/a
5 ccsbBroad304_15839 pLX_304 0% 85.6% 90% V5 (many diffs) n/a
6 TRCN0000469244 GTTCACACACCAAGACTTGCGCAA pLX_317 18.2% 85.6% 90% V5 (many diffs) n/a
Download CSV