Transcript: Human NM_001290061.1

Homo sapiens semaphorin 3B (SEMA3B), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
SEMA3B (7869)
Length:
2830
CDS:
81..2345

Additional Resources:

NCBI RefSeq record:
NM_001290061.1
NBCI Gene record:
SEMA3B (7869)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001290061.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000222102 CCCAAGTTTGTCAAGGTATTT pLKO.1 747 CDS 100% 13.200 18.480 N SEMA3B n/a
2 TRCN0000222103 GCCAATTACACCTTCACTCAA pLKO.1 1371 CDS 100% 4.950 6.930 N SEMA3B n/a
3 TRCN0000222106 CTTCAGTTCCACCAAGGACTT pLKO.1 1256 CDS 100% 4.050 3.240 N SEMA3B n/a
4 TRCN0000378985 CTGTCACCAGCATGCAAATTT pLKO_005 1555 CDS 100% 15.000 10.500 N SEMA3B n/a
5 TRCN0000222105 CCTACAAGTTGGAGCCAATTA pLKO.1 1358 CDS 100% 13.200 9.240 N SEMA3B n/a
6 TRCN0000373410 TGCCTACAACCGCACCCATTT pLKO_005 443 CDS 100% 10.800 7.560 N SEMA3B n/a
7 TRCN0000222104 CCTGGCATGGTCTCCAGACTT pLKO.1 199 CDS 100% 1.650 1.155 N SEMA3B n/a
8 TRCN0000373411 ACCTCATGGGACGAGACTTTA pLKO_005 655 CDS 100% 13.200 7.920 N SEMA3B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001290061.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01837 pDONR223 100% 99.2% 99% None 923_937del;1005_1007delCAG n/a
2 ccsbBroad304_01837 pLX_304 0% 99.2% 99% V5 923_937del;1005_1007delCAG n/a
3 ccsbBroadEn_11245 pDONR223 100% 84.2% 84% None 1_339del;923_937del;1005_1007delCAG n/a
4 ccsbBroad304_11245 pLX_304 0% 84.2% 84% V5 1_339del;923_937del;1005_1007delCAG n/a
Download CSV