Transcript: Human NM_001290117.1

Homo sapiens translocase of inner mitochondrial membrane 23 homolog B (TIMM23B), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
TIMM23B (100652748)
Length:
2533
CDS:
163..729

Additional Resources:

NCBI RefSeq record:
NM_001290117.1
NBCI Gene record:
TIMM23B (100652748)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001290117.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000008902 CCTCCCAAAGTGTTGGGATTA pLKO.1 1719 3UTR 100% 1.080 0.540 Y GPR83 n/a
2 TRCN0000156315 CCTCCCAAAGTGTTGGGATTA pLKO.1 1719 3UTR 100% 1.080 0.540 Y MYORG n/a
3 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 1591 3UTR 100% 2.640 1.320 Y LINC01098 n/a
4 TRCN0000178920 CCTTCTTTACGATTGGAGGAT pLKO.1 389 CDS 100% 2.640 1.320 Y TIMM23 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001290117.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02428 pDONR223 100% 86.2% 80.8% None (many diffs) n/a
2 ccsbBroad304_02428 pLX_304 0% 86.2% 80.8% V5 (many diffs) n/a
3 ccsbBroadEn_11498 pDONR223 100% 85.8% 80.3% None (many diffs) n/a
4 ccsbBroad304_11498 pLX_304 0% 85.8% 80.3% V5 (many diffs) n/a
5 TRCN0000471893 GGGCTAAATTTTAGCTTGGTCAGC pLX_317 74.2% 85.8% 80.3% V5 (many diffs) n/a
Download CSV