Transcript: Human NM_001290224.1

Homo sapiens transmembrane phosphatase with tensin homology (TPTE), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
TPTE (7179)
Length:
2489
CDS:
530..1771

Additional Resources:

NCBI RefSeq record:
NM_001290224.1
NBCI Gene record:
TPTE (7179)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001290224.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000355931 GTTCGGTACTTGATAACATTA pLKO_005 1467 CDS 100% 13.200 18.480 N TPTE n/a
2 TRCN0000355868 TCGTTATGTACGTGATCTAAA pLKO_005 1390 CDS 100% 13.200 18.480 N TPTE n/a
3 TRCN0000050104 TACTTCTGGTTGCACACATCT pLKO.1 1598 CDS 100% 4.950 3.960 N TPTE n/a
4 TRCN0000355867 GAGAATTTATCCATCAGATTT pLKO_005 1687 CDS 100% 13.200 9.240 N TPTE n/a
5 TRCN0000355866 ACAGATAGAACAGGAACTATG pLKO_005 1139 CDS 100% 10.800 7.560 N TPTE n/a
6 TRCN0000050105 TAAAGGAGGCACAGATAGAAC pLKO.1 1129 CDS 100% 4.950 3.465 N TPTE n/a
7 TRCN0000050106 CATTATTTATTCGATTCCTCG pLKO.1 1372 CDS 100% 2.160 1.296 N TPTE n/a
8 TRCN0000052815 CCTTTGGAGTATCGTTCTATT pLKO.1 482 5UTR 100% 13.200 6.600 Y TPTEP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001290224.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09359 pDONR223 100% 80.6% 67.8% None (many diffs) n/a
2 ccsbBroad304_09359 pLX_304 0% 80.6% 67.8% V5 (many diffs) n/a
3 TRCN0000476938 CCCCATGTCTGGCCCGTCAAGACC pLX_317 35.7% 80.6% 67.8% V5 (many diffs) n/a
4 ccsbBroadEn_07096 pDONR223 100% 77.4% 77.2% None 0_1ins360;995T>C n/a
5 ccsbBroad304_07096 pLX_304 0% 77.4% 77.2% V5 0_1ins360;995T>C n/a
Download CSV