Transcript: Human NM_001290225.2

Homo sapiens phosphatidylserine synthase 1 (PTDSS1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
PTDSS1 (9791)
Length:
4820
CDS:
408..1391

Additional Resources:

NCBI RefSeq record:
NM_001290225.2
NBCI Gene record:
PTDSS1 (9791)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001290225.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045810 TGGACCTATGTTCGATGGTTT pLKO.1 783 CDS 100% 4.950 6.930 N PTDSS1 n/a
2 TRCN0000333637 TGGACCTATGTTCGATGGTTT pLKO_005 783 CDS 100% 4.950 6.930 N PTDSS1 n/a
3 TRCN0000045811 GCAACAACGAAAGCCATTCTT pLKO.1 1312 CDS 100% 5.625 3.938 N PTDSS1 n/a
4 TRCN0000045812 GACTGAGTTGAATACCTTCTT pLKO.1 866 CDS 100% 4.950 3.465 N PTDSS1 n/a
5 TRCN0000291009 GACTGAGTTGAATACCTTCTT pLKO_005 866 CDS 100% 4.950 3.465 N PTDSS1 n/a
6 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 4558 3UTR 100% 4.950 2.475 Y ERAP2 n/a
7 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 4559 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001290225.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11415 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_11415 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000491791 ACCCCGACGTTAGTAAGTAGCTGG pLX_317 35.8% 100% 100% V5 n/a
4 ccsbBroadEn_02244 pDONR223 100% 69.1% 69.1% None 0_1ins438 n/a
5 TRCN0000468238 GCACTTCACATACGTATCAACTTC pLX_317 32.3% 69.1% 69.1% V5 0_1ins438 n/a
Download CSV