Transcript: Human NM_001290309.3

Homo sapiens catenin alpha 1 (CTNNA1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
CTNNA1 (1495)
Length:
3558
CDS:
202..2613

Additional Resources:

NCBI RefSeq record:
NM_001290309.3
NBCI Gene record:
CTNNA1 (1495)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001290309.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234534 CCCTCTGTCCTCAGGTTATTA pLKO_005 1268 CDS 100% 15.000 10.500 N CTNNA1 n/a
2 TRCN0000234532 GACTTAGGAATCCAGTATAAA pLKO_005 406 CDS 100% 15.000 10.500 N CTNNA1 n/a
3 TRCN0000234535 CAGTGTCTCGATGCCATAATC pLKO_005 3237 3UTR 100% 13.200 9.240 N CTNNA1 n/a
4 TRCN0000234533 CCTGATGTCGCAGCCTATAAG pLKO_005 586 CDS 100% 13.200 9.240 N CTNNA1 n/a
5 TRCN0000062654 GCACTCAATAACTTTGACAAA pLKO.1 733 CDS 100% 4.950 3.465 N CTNNA1 n/a
6 TRCN0000062653 CCACATTAGCTTGTTAGTAAT pLKO.1 2871 3UTR 100% 13.200 7.920 N CTNNA1 n/a
7 TRCN0000062657 GCTGGCAATGAACAAGACTTA pLKO.1 391 CDS 100% 4.950 2.970 N CTNNA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001290309.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10759 pDONR223 100% 66.6% 66.7% None 1_801del;1752G>A;1911G>A n/a
2 ccsbBroad304_10759 pLX_304 0% 66.6% 66.7% V5 1_801del;1752G>A;1911G>A n/a
3 TRCN0000469946 TCGTTAACGTGATGTTACGGGCCT pLX_317 29.4% 66.6% 66.7% V5 1_801del;1752G>A;1911G>A n/a
Download CSV