Transcript: Human NM_001290787.2

Homo sapiens endothelin converting enzyme like 1 (ECEL1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
ECEL1 (9427)
Length:
2865
CDS:
218..2539

Additional Resources:

NCBI RefSeq record:
NM_001290787.2
NBCI Gene record:
ECEL1 (9427)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001290787.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046999 GCGCTCAATGCCTACTATCTA pLKO.1 1916 CDS 100% 5.625 7.875 N ECEL1 n/a
2 TRCN0000047000 CCATGAGAAGACCTACTTCAA pLKO.1 1807 CDS 100% 4.950 3.465 N ECEL1 n/a
3 TRCN0000046998 CGTCCGTCTCTATGACAACTT pLKO.1 2161 CDS 100% 4.950 3.465 N ECEL1 n/a
4 TRCN0000438099 GAAGATCCTGGCAGCATACAG pLKO_005 1069 CDS 100% 4.950 3.465 N ECEL1 n/a
5 TRCN0000433051 GCTAGTGGAAGACATCAAGTA pLKO_005 1633 CDS 100% 4.950 3.465 N ECEL1 n/a
6 TRCN0000047001 CCCGACGACAAGCTCACCTAT pLKO.1 638 CDS 100% 1.650 1.155 N ECEL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001290787.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07415 pDONR223 100% 99.6% 99.6% None 982C>T;1679_1680insGTCCAC n/a
2 ccsbBroad304_07415 pLX_304 0% 99.6% 99.6% V5 982C>T;1679_1680insGTCCAC n/a
3 TRCN0000480017 GTCCCGGCGGGTACTAGCGGGCGC pLX_317 17.3% 99.6% 99.6% V5 982C>T;1679_1680insGTCCAC n/a
4 ccsbBroadEn_10359 pDONR223 100% 4.9% 4.6% None (many diffs) n/a
5 ccsbBroad304_10359 pLX_304 0% 4.9% 4.6% V5 (many diffs) n/a
6 TRCN0000471406 CCTTCATAAAGATATCAGTCACTG pLX_317 100% 4.9% 4.6% V5 (many diffs) n/a
Download CSV