Transcript: Mouse NM_001291122.1

Mus musculus erythrocyte membrane protein band 4.1 like 1 (Epb41l1), transcript variant 6, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Epb41l1 (13821)
Length:
6062
CDS:
455..2650

Additional Resources:

NCBI RefSeq record:
NM_001291122.1
NBCI Gene record:
Epb41l1 (13821)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001291122.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000089939 CCGTTCTCTTTCACCGATCAT pLKO.1 2344 CDS 100% 4.950 6.930 N Epb41l1 n/a
2 TRCN0000325892 CCGTTCTCTTTCACCGATCAT pLKO_005 2344 CDS 100% 4.950 6.930 N Epb41l1 n/a
3 TRCN0000116474 CCACGGAAATCCGTTCTCTTT pLKO.1 2334 CDS 100% 4.950 3.465 N EPB41L1 n/a
4 TRCN0000089941 CCAGACATGCTGGTAACCAAA pLKO.1 2564 CDS 100% 4.950 3.465 N Epb41l1 n/a
5 TRCN0000325820 CCAGACATGCTGGTAACCAAA pLKO_005 2564 CDS 100% 4.950 3.465 N Epb41l1 n/a
6 TRCN0000089942 GAGGAGTAACTTCTACATCAA pLKO.1 1444 CDS 100% 4.950 3.465 N Epb41l1 n/a
7 TRCN0000354072 GAGGAGTAACTTCTACATCAA pLKO_005 1444 CDS 100% 4.950 3.465 N Epb41l1 n/a
8 TRCN0000089938 CGGTTGGCTATTTGCCAAGAA pLKO.1 3186 3UTR 100% 0.495 0.347 N Epb41l1 n/a
9 TRCN0000325819 CGGTTGGCTATTTGCCAAGAA pLKO_005 3186 3UTR 100% 0.495 0.347 N Epb41l1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001291122.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13853 pDONR223 100% 75.6% .6% None (many diffs) n/a
2 ccsbBroad304_13853 pLX_304 0% 75.6% .6% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000473176 TATGTAAATCCTCTGCTGACGAAA pLX_317 1.2% 75.6% .6% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_00505 pDONR223 100% 71.7% 72.1% None (many diffs) n/a
5 ccsbBroad304_00505 pLX_304 0% 71.7% 72.1% V5 (many diffs) n/a
6 TRCN0000472080 CGCAGGTTGCACAGAATGCTCGGT pLX_317 10.9% 71.7% 72.1% V5 (many diffs) n/a
Download CSV