Transcript: Human NM_001291489.2

Homo sapiens zinc finger protein 285 (ZNF285), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
ZNF285 (26974)
Length:
6122
CDS:
176..1948

Additional Resources:

NCBI RefSeq record:
NM_001291489.2
NBCI Gene record:
ZNF285 (26974)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001291489.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000015355 CTTTCGCAAGAAGTGCTTCAT pLKO.1 371 CDS 100% 4.950 3.465 N ZNF285 n/a
2 TRCN0000015353 CGGAATTCAGATCTTAATGTT pLKO.1 1742 CDS 100% 0.000 0.000 N ZNF285 n/a
3 TRCN0000015357 TCTTCCCTTCACAACCATCAT pLKO.1 1160 CDS 100% 4.950 2.970 N ZNF285 n/a
4 TRCN0000015354 CAGGATTATATCGTGAACCTT pLKO.1 437 CDS 100% 3.000 1.800 N ZNF285 n/a
5 TRCN0000015356 GAGAAACCATACAAATGCAAT pLKO.1 1532 CDS 100% 4.950 2.475 Y ZNF285 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001291489.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08039 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_08039 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469631 TTGTACGGTATTTGGCTGAATTAT pLX_317 25.3% 100% 100% V5 n/a
4 ccsbBroadEn_14112 pDONR223 100% 73.6% 73.2% None 1_465del;1762delG n/a
5 ccsbBroad304_14112 pLX_304 0% 73.6% 73.2% V5 (not translated due to frame shift) 1_465del;1762delG n/a
6 TRCN0000476357 CGGACGGCTCCCGCTGATGTTAGA pLX_317 27% 73.6% 73.2% V5 (not translated due to frame shift) 1_465del;1762delG n/a
Download CSV