Transcript: Mouse NM_001293313.1

Mus musculus NME/NM23 family member 7 (Nme7), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Nme7 (171567)
Length:
1737
CDS:
298..1485

Additional Resources:

NCBI RefSeq record:
NM_001293313.1
NBCI Gene record:
Nme7 (171567)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001293313.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000024704 GTGAGGAATGTGTTCATTCTT pLKO.1 1541 3UTR 100% 0.563 0.450 N Nme7 n/a
2 TRCN0000024708 CGCCTGGAAGATCTATTTATA pLKO.1 520 CDS 100% 15.000 10.500 N Nme7 n/a
3 TRCN0000024707 GCCAGCGAACACTGCTAAATT pLKO.1 1041 CDS 100% 15.000 10.500 N Nme7 n/a
4 TRCN0000337536 GCCAGCGAACACTGCTAAATT pLKO_005 1041 CDS 100% 15.000 10.500 N Nme7 n/a
5 TRCN0000374088 GGTGTAGTGTCTGAGTATAAT pLKO_005 1222 CDS 100% 15.000 10.500 N Nme7 n/a
6 TRCN0000374089 AGTTTGGTTTCTCCATATATG pLKO_005 328 CDS 100% 13.200 9.240 N Nme7 n/a
7 TRCN0000024705 GCCAGAGAAATGGAATTGTTT pLKO.1 997 CDS 100% 5.625 3.938 N Nme7 n/a
8 TRCN0000337535 GCCAGAGAAATGGAATTGTTT pLKO_005 997 CDS 100% 5.625 3.938 N Nme7 n/a
9 TRCN0000350800 TGCGCCTGGAAGATCTATTTA pLKO_005 518 CDS 100% 15.000 9.000 N Nme7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001293313.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000492222 TCGCCAAGGAAAGCTCCCAACTTA pLX_317 40.7% 81.1% 65% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000491534 GGAAATTTTTCTTCTCAGCGAGCA pLX_317 28.9% 81.1% 83.8% V5 (many diffs) n/a
3 ccsbBroadEn_15052 pDONR223 0% 81.1% 84% None (many diffs) n/a
4 ccsbBroad304_15052 pLX_304 45.1% 81.1% 84% V5 (many diffs) n/a
5 TRCN0000481255 ACTCATTCTGAACGTGCAGCACGG pLX_317 36.6% 81.1% 84% V5 (many diffs) n/a
6 TRCN0000489327 CGATATTTAACATCTACACACTGA pLX_317 29.2% 81.1% 84% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV