Transcript: Mouse NM_001294329.1

Mus musculus tousled-like kinase 2 (Arabidopsis) (Tlk2), transcript variant C, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Tlk2 (24086)
Length:
5341
CDS:
700..2640

Additional Resources:

NCBI RefSeq record:
NM_001294329.1
NBCI Gene record:
Tlk2 (24086)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001294329.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000356116 TGACCTCAAACCAGGTAATAT pLKO_005 2094 CDS 100% 15.000 21.000 N TLK2 n/a
2 TRCN0000027013 GCAACCAATGAGCAGAAACAA pLKO.1 1453 CDS 100% 5.625 4.500 N Tlk2 n/a
3 TRCN0000322066 GCAACCAATGAGCAGAAACAA pLKO_005 1453 CDS 100% 5.625 4.500 N Tlk2 n/a
4 TRCN0000026998 CGATTGCGATTAGGCCACTTT pLKO.1 1264 CDS 100% 4.950 3.960 N Tlk2 n/a
5 TRCN0000322065 CGATTGCGATTAGGCCACTTT pLKO_005 1264 CDS 100% 4.950 3.960 N Tlk2 n/a
6 TRCN0000322129 GCTGGTACTTATTGGTATTTA pLKO_005 2233 CDS 100% 15.000 10.500 N Tlk2 n/a
7 TRCN0000356159 GCTGGTACTTATTGGTATTTA pLKO_005 2233 CDS 100% 15.000 10.500 N TLK2 n/a
8 TRCN0000221175 CACTGGAGTTGGTGTAAGTAA pLKO.1 587 5UTR 100% 5.625 3.938 N LOC385236 n/a
9 TRCN0000026976 CGAAAGGAAGATCGCATTGAT pLKO.1 2494 CDS 100% 5.625 3.938 N Tlk2 n/a
10 TRCN0000322067 CGAAAGGAAGATCGCATTGAT pLKO_005 2494 CDS 100% 5.625 3.938 N Tlk2 n/a
11 TRCN0000026990 CGATCCATTATTATGCAGATT pLKO.1 2023 CDS 100% 4.950 3.465 N Tlk2 n/a
12 TRCN0000002364 CAGTGAAGTTTACAAGGCATT pLKO.1 1740 CDS 100% 4.050 2.835 N TLK2 n/a
13 TRCN0000027016 CCAGTGTCTTTATGGGAGGAA pLKO.1 2337 CDS 100% 2.640 1.848 N Tlk2 n/a
14 TRCN0000221174 CCACGAAGGCAGGAATTACTA pLKO.1 555 5UTR 100% 5.625 2.813 Y LOC385236 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001294329.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487715 TATTTCCAATGAACCAGATCAATC pLX_317 11.4% 80.4% 83.7% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000489119 TACCTGTAGTGACCTCCCATAAGG pLX_317 13.2% 80.4% 83.7% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000488113 TATTTTACTACGACAAAGTGCAGT pLX_317 11.3% 80.4% 83.6% V5 (many diffs) n/a
4 TRCN0000491778 AGGCAAGCATAGGGACCATCCCTT pLX_317 16.4% 80.4% 83.6% V5 (many diffs) n/a
5 ccsbBroadEn_11580 pDONR223 100% 78.2% 81.4% None (many diffs) n/a
6 ccsbBroad304_11580 pLX_304 0% 78.2% 81.4% V5 (many diffs) n/a
7 TRCN0000478401 TTACCGGTATGCAGATCCGGTTTT pLX_317 11.1% 78.2% 81.4% V5 (many diffs) n/a
8 ccsbBroadEn_14984 pDONR223 0% 78.2% 81.4% None (many diffs) n/a
9 ccsbBroad304_14984 pLX_304 0% 78.2% 81.4% V5 (many diffs) n/a
10 TRCN0000474191 TTCGATGTTAGGTGTGTATCGATA pLX_317 18.7% 78.2% 81.4% V5 (many diffs) n/a
Download CSV