Transcript: Human NM_001300947.2

Homo sapiens cleavage and polyadenylation specific factor 6 (CPSF6), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
CPSF6 (11052)
Length:
6695
CDS:
79..1845

Additional Resources:

NCBI RefSeq record:
NM_001300947.2
NBCI Gene record:
CPSF6 (11052)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001300947.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000237832 AGACCGTCATGACGATTATTA pLKO_005 1731 CDS 100% 15.000 21.000 N CPSF6 n/a
2 TRCN0000237831 ATCGTTGCAAAGTTCTTATTA pLKO_005 1580 CDS 100% 15.000 21.000 N CPSF6 n/a
3 TRCN0000000154 ACCATAGTAGATCACGAGAAA pLKO.1 1682 CDS 100% 4.950 6.930 N CPSF6 n/a
4 TRCN0000216859 GGTGATTATGGGAGTGCTATT pLKO.1 1504 CDS 100% 10.800 8.640 N Cpsf6 n/a
5 TRCN0000244314 GGTGATTATGGGAGTGCTATT pLKO_005 1504 CDS 100% 10.800 8.640 N CPSF6 n/a
6 TRCN0000237833 GTTGTAACTCCATGCAATAAA pLKO_005 541 CDS 100% 15.000 10.500 N CPSF6 n/a
7 TRCN0000237834 TAGGTGATTACATGGATATTT pLKO_005 2490 3UTR 100% 15.000 10.500 N CPSF6 n/a
8 TRCN0000216382 GCAACTTTATTACTGGTTATA pLKO.1 2093 3UTR 100% 13.200 9.240 N Cpsf6 n/a
9 TRCN0000217768 GCAATCTCAAGCAGTGCTATT pLKO.1 1456 CDS 100% 10.800 7.560 N Cpsf6 n/a
10 TRCN0000000153 CACTGGTAACTGCAATTTCTT pLKO.1 1529 CDS 100% 5.625 3.938 N CPSF6 n/a
11 TRCN0000175303 CCTGTTGTAACTCCATGCAAT pLKO.1 538 CDS 100% 4.950 3.465 N Cpsf6 n/a
12 TRCN0000000150 GCAGCAGGTAAATGTGAGTAA pLKO.1 2851 3UTR 100% 4.950 3.465 N CPSF6 n/a
13 TRCN0000000152 GAAATCTAACATGGTGGACAA pLKO.1 335 CDS 100% 4.050 2.835 N CPSF6 n/a
14 TRCN0000000151 CTGGTGATTATGGGAGTGCTA pLKO.1 1502 CDS 100% 2.640 1.848 N CPSF6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001300947.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11586 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_11586 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469395 ATTAGGCCTGGAATAATTAAGGAA pLX_317 22% 100% 100% V5 n/a
4 ccsbBroadEn_11585 pDONR223 100% 81.1% 81.2% None 354G>A;561_890del;1578A>G n/a
5 ccsbBroad304_11585 pLX_304 0% 81.1% 81.2% V5 354G>A;561_890del;1578A>G n/a
6 TRCN0000472490 TCGATTGCACTATGTTAGAATGAT pLX_317 31.4% 81.1% 81.2% V5 354G>A;561_890del;1578A>G n/a
Download CSV