Transcript: Human NM_001300985.2

Homo sapiens polypyrimidine tract binding protein 2 (PTBP2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
PTBP2 (58155)
Length:
12029
CDS:
82..1695

Additional Resources:

NCBI RefSeq record:
NM_001300985.2
NBCI Gene record:
PTBP2 (58155)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001300985.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001111 CCCTAGATGGTCAGAATATTT pLKO.1 791 CDS 100% 15.000 21.000 N PTBP2 n/a
2 TRCN0000418376 GCAGCTATTACTATGGTTAAT pLKO_005 397 CDS 100% 13.200 18.480 N PTBP2 n/a
3 TRCN0000001110 GCCACCCTTCACCTATCTAAT pLKO.1 1459 CDS 100% 13.200 18.480 N PTBP2 n/a
4 TRCN0000435789 GTTCAATGTCATCACCTATTT pLKO_005 1731 3UTR 100% 13.200 18.480 N PTBP2 n/a
5 TRCN0000422572 TAAGAAAGACAGCGCTCTAAT pLKO_005 1215 CDS 100% 13.200 18.480 N PTBP2 n/a
6 TRCN0000109231 GCTGTACCCTAAGGATTGATT pLKO.1 821 CDS 100% 5.625 7.875 N Ptbp2 n/a
7 TRCN0000317485 GCTGTACCCTAAGGATTGATT pLKO_005 821 CDS 100% 5.625 7.875 N Ptbp2 n/a
8 TRCN0000419376 CCTGTTGGTTAGCAATTTAAA pLKO_005 1113 CDS 100% 15.000 10.500 N PTBP2 n/a
9 TRCN0000436348 CCAGTATGGTGATCCAGTAAA pLKO_005 750 CDS 100% 13.200 9.240 N PTBP2 n/a
10 TRCN0000418847 GTTTACCCTCTTCGGTGTTTA pLKO_005 1161 CDS 100% 13.200 9.240 N PTBP2 n/a
11 TRCN0000422912 AGCCCAGAGTCCAGTACTTAG pLKO_005 606 CDS 100% 10.800 7.560 N PTBP2 n/a
12 TRCN0000001112 CATCTTCGTAACCAACCAATA pLKO.1 439 CDS 100% 10.800 7.560 N PTBP2 n/a
13 TRCN0000001109 CTGTTATCATTCCTTGGTTAT pLKO.1 1829 3UTR 100% 10.800 7.560 N PTBP2 n/a
14 TRCN0000001113 CTCCTTCTCGTGTACTTCATA pLKO.1 248 CDS 100% 5.625 3.938 N PTBP2 n/a
15 TRCN0000109230 GCTGTTATCATTCCTTGGTTA pLKO.1 1828 3UTR 100% 4.950 3.465 N Ptbp2 n/a
16 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 11471 3UTR 100% 4.950 2.475 Y LOC387873 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001300985.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14237 pDONR223 100% 99% 99% None 903_917del;1599C>A n/a
2 ccsbBroad304_14237 pLX_304 0% 99% 99% V5 (not translated due to frame shift) 903_917del;1599C>A n/a
3 TRCN0000473640 AAGAATCTGTTACTACTTCAAATT pLX_317 32.9% 99% 99% V5 (not translated due to frame shift) 903_917del;1599C>A n/a
Download CSV