Transcript: Mouse NM_001302205.1

Mus musculus LIM domain only 1 (Lmo1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Lmo1 (109594)
Length:
1022
CDS:
249..716

Additional Resources:

NCBI RefSeq record:
NM_001302205.1
NBCI Gene record:
Lmo1 (109594)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001302205.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412467 GTTCAGTAACGCCCACCATCT pLKO_005 708 CDS 100% 4.050 5.670 N Lmo1 n/a
2 TRCN0000413245 AGCCTGTACAGTCTGTCTTCT pLKO_005 912 3UTR 100% 4.950 3.960 N Lmo1 n/a
3 TRCN0000417349 AGCCGCTGTCCTACAAGTTAG pLKO_005 812 3UTR 100% 10.800 7.560 N Lmo1 n/a
4 TRCN0000412264 ATGCTCTCCGTCCAACCTAAG pLKO_005 279 CDS 100% 6.000 4.200 N Lmo1 n/a
5 TRCN0000054564 CATCTCAATGGCACCTTTGAA pLKO.1 681 CDS 100% 5.625 3.938 N Lmo1 n/a
6 TRCN0000422666 TTTGCGTGGGAGACAAATTCT pLKO_005 613 CDS 100% 5.625 3.938 N Lmo1 n/a
7 TRCN0000054567 CCTGAAGAACAACATGATCTT pLKO.1 635 CDS 100% 4.950 3.465 N Lmo1 n/a
8 TRCN0000054566 CCGAGACAATGTGTATCACCT pLKO.1 557 CDS 100% 2.640 1.848 N Lmo1 n/a
9 TRCN0000054565 CGCAGGCTGCAACCGCAAGAT pLKO.1 317 CDS 100% 0.000 0.000 N Lmo1 n/a
10 TRCN0000054563 CGGCGTGACTACCTGAGGCTT pLKO.1 468 CDS 100% 0.000 0.000 N Lmo1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001302205.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06530 pDONR223 100% 91.6% 97.4% None (many diffs) n/a
2 ccsbBroad304_06530 pLX_304 0% 91.6% 97.4% V5 (many diffs) n/a
3 TRCN0000473676 TTTATAGTACTATCGAGGGAACTC pLX_317 98.7% 91.6% 97.4% V5 (many diffs) n/a
4 ccsbBroadEn_03676 pDONR223 100% 73.7% 83.8% None (many diffs) n/a
5 ccsbBroad304_03676 pLX_304 0% 73.7% 83.8% V5 (many diffs) n/a
6 TRCN0000467106 AGCGATGATACCCTAACGCCTAGG pLX_317 70.9% 73.7% 83.8% V5 (many diffs) n/a
Download CSV