Transcript: Human NM_001303237.2

Homo sapiens interferon stimulated exonuclease gene 20 (ISG20), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
ISG20 (3669)
Length:
1523
CDS:
86..571

Additional Resources:

NCBI RefSeq record:
NM_001303237.2
NBCI Gene record:
ISG20 (3669)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001303237.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430756 CCGATTACAGAACCCGGGTCA pLKO_005 234 CDS 100% 0.720 1.008 N ISG20 n/a
2 TRCN0000425903 GACATGAGCGGCTACACAATC pLKO_005 326 CDS 100% 10.800 8.640 N ISG20 n/a
3 TRCN0000049940 TGAGGGAGAGATCACCGATTA pLKO.1 220 CDS 100% 10.800 7.560 N ISG20 n/a
4 TRCN0000049938 GCAACGATGGAGCTCTATCAA pLKO.1 494 CDS 100% 5.625 3.938 N ISG20 n/a
5 TRCN0000423399 AGGCACTGAAAGAGGACATGA pLKO_005 312 CDS 100% 4.950 3.465 N ISG20 n/a
6 TRCN0000049942 CTATCAAATCTCCCAGAGAAT pLKO.1 508 CDS 100% 4.950 3.465 N ISG20 n/a
7 TRCN0000415098 GCTGTGCTGTACGACAAGTTC pLKO_005 191 CDS 100% 4.950 3.465 N ISG20 n/a
8 TRCN0000423138 ATCTACGACACGTCCACTGAC pLKO_005 344 CDS 100% 4.050 2.835 N ISG20 n/a
9 TRCN0000423648 TTGGACACAGCTCGGTGGAAG pLKO_005 465 CDS 100% 1.350 0.945 N ISG20 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001303237.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00883 pDONR223 100% 88.7% 88.9% None 226_227ins60;354A>G n/a
2 ccsbBroad304_00883 pLX_304 0% 88.7% 88.9% V5 226_227ins60;354A>G n/a
3 TRCN0000474035 AGGCTTCCTAATGATCTTCTGGTA pLX_317 82.7% 88.7% 88.9% V5 226_227ins60;354A>G n/a
4 ccsbBroadEn_10924 pDONR223 100% 52% 45.2% None (many diffs) n/a
5 ccsbBroad304_10924 pLX_304 0% 52% 45.2% V5 (many diffs) n/a
6 TRCN0000471409 ATGATTAATCTAATGAATATATAT pLX_317 76.8% 52% 45.2% V5 (many diffs) n/a
7 TRCN0000491261 CGGAAAGATACCACACAATGCCTA pLX_317 70.6% 52% 45.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV