Transcript: Mouse NM_001304950.1

Mus musculus opioid receptor, mu 1 (Oprm1), transcript variant MOR-1D, mRNA.

Source:
NCBI, updated 2017-06-15
Taxon:
Mus musculus (mouse)
Gene:
Oprm1 (18390)
Length:
2581
CDS:
306..1487

Additional Resources:

NCBI RefSeq record:
NM_001304950.1
NBCI Gene record:
Oprm1 (18390)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001304950.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000027764 CGTGATCTCAATAGACTACTA pLKO.1 731 CDS 100% 4.950 6.930 N Oprm1 n/a
2 TRCN0000027835 CGGCTAATACAGTGGATCGAA pLKO.1 1432 CDS 100% 3.000 4.200 N Oprm1 n/a
3 TRCN0000027844 CTGGTCATGTATGTGATTGTA pLKO.1 567 CDS 100% 5.625 3.938 N Oprm1 n/a
4 TRCN0000027786 CCTCCACAATCGAACAGCAAA pLKO.1 1369 CDS 100% 4.950 3.465 N Oprm1 n/a
5 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2543 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001304950.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01122 pDONR223 100% 85.6% 91.5% None (many diffs) n/a
2 ccsbBroad304_01122 pLX_304 0% 85.6% 91.5% V5 (many diffs) n/a
3 TRCN0000492306 TTGATCTCAAGGTTACTTTAACGC pLX_317 30.6% 74.1% 79.2% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000488117 GCCCGGGTCACCAAGCGACCACCG pLX_317 15.7% 74% 79% V5 (many diffs) n/a
Download CSV