Construct: ORF TRCN0000492306
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021064.2_s317c1
- DNA Barcode:
- TTGATCTCAAGGTTACTTTAACGC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- OPRM1 (4988)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000492306
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 4988 | OPRM1 | opioid receptor mu 1 | NM_001145279.3 | 92.8% | 90.6% | (many diffs) |
| 2 | human | 4988 | OPRM1 | opioid receptor mu 1 | NM_001285524.1 | 92.8% | 90.6% | (many diffs) |
| 3 | human | 4988 | OPRM1 | opioid receptor mu 1 | NM_000914.4 | 86.5% | 86.5% | 0_1ins186;135C>T |
| 4 | human | 4988 | OPRM1 | opioid receptor mu 1 | NR_104349.1 | 84.9% | (many diffs) | |
| 5 | human | 4988 | OPRM1 | opioid receptor mu 1 | NM_001145283.2 | 84.8% | 84.1% | (many diffs) |
| 6 | human | 4988 | OPRM1 | opioid receptor mu 1 | NM_001008504.3 | 84.3% | 84.1% | (many diffs) |
| 7 | human | 4988 | OPRM1 | opioid receptor mu 1 | NM_001145284.3 | 84.3% | 82.9% | (many diffs) |
| 8 | human | 4988 | OPRM1 | opioid receptor mu 1 | NM_001145285.2 | 84.1% | 83.9% | (many diffs) |
| 9 | human | 4988 | OPRM1 | opioid receptor mu 1 | NM_001145282.2 | 83.2% | 83.3% | (many diffs) |
| 10 | human | 4988 | OPRM1 | opioid receptor mu 1 | NM_001285523.2 | 82.4% | 81.9% | (many diffs) |
| 11 | human | 4988 | OPRM1 | opioid receptor mu 1 | NM_001145286.2 | 82.3% | 81.9% | (many diffs) |
| 12 | human | 4988 | OPRM1 | opioid receptor mu 1 | NM_001008503.2 | 81% | 79.9% | (many diffs) |
| 13 | human | 4988 | OPRM1 | opioid receptor mu 1 | NM_001008505.2 | 77.9% | 75.7% | (many diffs) |
| 14 | human | 4988 | OPRM1 | opioid receptor mu 1 | NM_001145281.2 | 67.6% | 66.6% | (many diffs) |
| 15 | human | 4988 | OPRM1 | opioid receptor mu 1 | NM_001145280.3 | 64.9% | 64.9% | 0_1ins486 |
| 16 | human | 4988 | OPRM1 | opioid receptor mu 1 | NM_001145287.2 | 64.9% | 64.9% | 0_1ins486 |
| 17 | human | 4988 | OPRM1 | opioid receptor mu 1 | NM_001285526.1 | 64.9% | 64.9% | 0_1ins486 |
| 18 | human | 4988 | OPRM1 | opioid receptor mu 1 | XM_017010906.2 | 64.9% | 64.9% | 0_1ins486 |
| 19 | human | 4988 | OPRM1 | opioid receptor mu 1 | NM_001285527.1 | 62.7% | 62.5% | (many diffs) |
| 20 | human | 4988 | OPRM1 | opioid receptor mu 1 | NM_001285528.2 | 61.5% | 61% | (many diffs) |
| 21 | human | 4988 | OPRM1 | opioid receptor mu 1 | XM_011535851.3 | 58.3% | 56.3% | (many diffs) |
| 22 | human | 4988 | OPRM1 | opioid receptor mu 1 | XM_011535853.2 | 58.3% | 56.3% | (many diffs) |
| 23 | human | 4988 | OPRM1 | opioid receptor mu 1 | XM_011535856.2 | 58.3% | 56.3% | (many diffs) |
| 24 | human | 4988 | OPRM1 | opioid receptor mu 1 | XM_011535862.2 | 58.3% | 56.3% | (many diffs) |
| 25 | human | 4988 | OPRM1 | opioid receptor mu 1 | XM_017010903.2 | 58.3% | 56.3% | (many diffs) |
| 26 | human | 4988 | OPRM1 | opioid receptor mu 1 | XM_017010904.1 | 58.3% | 56.3% | (many diffs) |
| 27 | human | 4988 | OPRM1 | opioid receptor mu 1 | XM_017010905.1 | 58.3% | 56.3% | (many diffs) |
| 28 | human | 4988 | OPRM1 | opioid receptor mu 1 | NR_104351.1 | 48.4% | (many diffs) | |
| 29 | human | 4988 | OPRM1 | opioid receptor mu 1 | XM_017010907.2 | 38.7% | 35.4% | (many diffs) |
| 30 | human | 4988 | OPRM1 | opioid receptor mu 1 | NM_001285522.1 | 20.8% | 20.7% | 0_1ins186;135C>T;291_291delCins910 |
| 31 | human | 4988 | OPRM1 | opioid receptor mu 1 | NR_104348.1 | 8.8% | (many diffs) | |
| 32 | human | 4988 | OPRM1 | opioid receptor mu 1 | NR_104350.1 | 6.5% | (many diffs) | |
| 33 | mouse | 18390 | Oprm1 | opioid receptor, mu 1 | NM_001302793.1 | 75.4% | 81.3% | (many diffs) |
| 34 | mouse | 18390 | Oprm1 | opioid receptor, mu 1 | NM_001304950.1 | 74.1% | 79.2% | (many diffs) |
| 35 | mouse | 18390 | Oprm1 | opioid receptor, mu 1 | NM_001304937.1 | 73.6% | 78.7% | (many diffs) |
| 36 | mouse | 18390 | Oprm1 | opioid receptor, mu 1 | NM_001304938.1 | 73.5% | 79% | (many diffs) |
| 37 | mouse | 18390 | Oprm1 | opioid receptor, mu 1 | XM_006512437.3 | 73% | 78.5% | (many diffs) |
| 38 | mouse | 18390 | Oprm1 | opioid receptor, mu 1 | NM_001304948.1 | 72.9% | 75.9% | (many diffs) |
| 39 | mouse | 18390 | Oprm1 | opioid receptor, mu 1 | XM_017313827.1 | 70.4% | 74% | (many diffs) |
| 40 | mouse | 18390 | Oprm1 | opioid receptor, mu 1 | NM_001039652.2 | 67.8% | 73.1% | (many diffs) |
| 41 | mouse | 18390 | Oprm1 | opioid receptor, mu 1 | XM_017313826.1 | 66.3% | 70.5% | (many diffs) |
| 42 | mouse | 18390 | Oprm1 | opioid receptor, mu 1 | NM_001304955.1 | 63.3% | 68.2% | (many diffs) |
| 43 | mouse | 18390 | Oprm1 | opioid receptor, mu 1 | NM_001302794.1 | 61.8% | 62% | (many diffs) |
| 44 | mouse | 18390 | Oprm1 | opioid receptor, mu 1 | NM_001302796.1 | 60.5% | 59.9% | (many diffs) |
| 45 | mouse | 18390 | Oprm1 | opioid receptor, mu 1 | NM_001302795.1 | 55.4% | 55.6% | (many diffs) |
| 46 | mouse | 18390 | Oprm1 | opioid receptor, mu 1 | XM_017313828.1 | 41.4% | 18.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1458
- ORF length:
- 1386
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgtcagat gctcagctcg gtcccctccg cctgacgctc ctctctgtct 121 cagccaggac tggtttctgt aagaaacagc aggagctgtg gcagcggcga aaggaagcgg 181 ctgaggcgct tggaacccga aaagtctcgg tgctcctggc tacctcgcac agcggtgccc 241 gcccggccgt cagtaccatg gacagcagcg ctgcccccac gaacgccagc aattgcactg 301 atgccttggc gtactcaagt tgctccccag cacccagccc cggttcctgg gtcaacttgt 361 cccacttaga tggcaacctg tccgacccat gtggtccgaa ccgcaccgac ctgggcggga 421 gagacagcct gtgccctccg accggcagtc cctccatgat cacggccatc acgatcatgg 481 ccctctactc catcgtgtgc gtggtggggc tcttcggaaa cttcctggtc atgtatgtga 541 ttgtcagata caccaagatg aagactgcca ccaacatcta cattttcaac cttgctctgg 601 cagatgcctt agccaccagt accctgccct tccagagtgt gaattaccta atgggaacat 661 ggccatttgg aaccatcctt tgcaagatag tgatctccat agattactat aacatgttca 721 ccagcatatt caccctctgc accatgagtg ttgatcgata cattgcagtc tgccaccctg 781 tcaaggcctt agatttccgt actccccgaa atgccaaaat tatcaatgtc tgcaactgga 841 tcctctcttc agccattggt cttcctgtaa tgttcatggc tacaacaaaa tacaggcaag 901 gttccataga ttgtacacta acattctctc atccaacctg gtactgggaa aacctgctga 961 agatctgtgt tttcatcttc gccttcatta tgccagtgct catcattacc gtgtgctatg 1021 gactgatgat cttgcgccTC AAGAGTGTCC GCATGCTCTC TGGCTCCAAA GAAAAGGACA 1081 GGAATCTTCG AAGGATCACC AGGATGGTGC TGGTGGTGGT GGCTGTGTTC ATCGTCTGCT 1141 GGACTCCCAT TCACATTTAC GTCATCATTA AAGCCTTGGT TACAATCCCA GAAACTACGT 1201 TCCAGACTGT TTCTTGGCAC TTCTGCATTG CTCTAGGTTA CACAAACAGC TGCCTCAACC 1261 CAGTCCTTTA TGCATTTCTG GATGAAAACT TCAAACGATG CTTCAGAGAG TTCTGTATCC 1321 CAACCTCTTC CAACATTGAG CAACAAAACT CCACTCGAAT TCGTCAGAAC ACTAGAGACC 1381 ACCCCTCCAC GGCCAATACA GTGGATAGAA CTAATCATCA GCTAGAAAAT CTGGAAGCAG 1441 AAACTGCTCC GTTGCCCTAA GACCCAGCTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 1501 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 1561 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGATTGA TCTCAAGGTT 1621 ACTTTAACGC ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt