Construct: ORF TRCN0000488117
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020023.1_s317c1
- DNA Barcode:
- GCCCGGGTCACCAAGCGACCACCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- OPRM1 (4988)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488117
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 4988 | OPRM1 | opioid receptor mu 1 | NM_001145279.3 | 92.7% | 90.4% | (many diffs) |
| 2 | human | 4988 | OPRM1 | opioid receptor mu 1 | NM_001285524.1 | 92.7% | 90.4% | (many diffs) |
| 3 | human | 4988 | OPRM1 | opioid receptor mu 1 | NM_000914.4 | 86.4% | 86.3% | 0_1ins186;135C>T;1200_1201insG |
| 4 | human | 4988 | OPRM1 | opioid receptor mu 1 | NM_001145283.2 | 85.2% | 84% | (many diffs) |
| 5 | human | 4988 | OPRM1 | opioid receptor mu 1 | NR_104349.1 | 85% | (many diffs) | |
| 6 | human | 4988 | OPRM1 | opioid receptor mu 1 | NM_001145284.3 | 84.3% | 82.7% | (many diffs) |
| 7 | human | 4988 | OPRM1 | opioid receptor mu 1 | NM_001008504.3 | 84.2% | 84% | (many diffs) |
| 8 | human | 4988 | OPRM1 | opioid receptor mu 1 | NM_001145285.2 | 84% | 83.8% | (many diffs) |
| 9 | human | 4988 | OPRM1 | opioid receptor mu 1 | NM_001145282.2 | 83.1% | 83.3% | (many diffs) |
| 10 | human | 4988 | OPRM1 | opioid receptor mu 1 | NM_001285523.2 | 83.1% | 81.9% | (many diffs) |
| 11 | human | 4988 | OPRM1 | opioid receptor mu 1 | NM_001145286.2 | 82.3% | 81.9% | (many diffs) |
| 12 | human | 4988 | OPRM1 | opioid receptor mu 1 | NM_001008503.2 | 81% | 79.9% | (many diffs) |
| 13 | human | 4988 | OPRM1 | opioid receptor mu 1 | NM_001008505.2 | 77.9% | 75.7% | (many diffs) |
| 14 | human | 4988 | OPRM1 | opioid receptor mu 1 | NM_001145281.2 | 67.5% | 66.5% | (many diffs) |
| 15 | human | 4988 | OPRM1 | opioid receptor mu 1 | NM_001145280.3 | 64.8% | 64.7% | 0_1ins486;900_901insG |
| 16 | human | 4988 | OPRM1 | opioid receptor mu 1 | NM_001145287.2 | 64.8% | 64.7% | 0_1ins486;900_901insG |
| 17 | human | 4988 | OPRM1 | opioid receptor mu 1 | NM_001285526.1 | 64.8% | 64.7% | 0_1ins486;900_901insG |
| 18 | human | 4988 | OPRM1 | opioid receptor mu 1 | XM_017010906.2 | 64.8% | 64.7% | 0_1ins486;900_901insG |
| 19 | human | 4988 | OPRM1 | opioid receptor mu 1 | NM_001285527.1 | 62.7% | 62.4% | (many diffs) |
| 20 | human | 4988 | OPRM1 | opioid receptor mu 1 | NM_001285528.2 | 62.2% | 61% | (many diffs) |
| 21 | human | 4988 | OPRM1 | opioid receptor mu 1 | XM_011535851.3 | 58.3% | 56.3% | (many diffs) |
| 22 | human | 4988 | OPRM1 | opioid receptor mu 1 | XM_011535853.2 | 58.3% | 56.3% | (many diffs) |
| 23 | human | 4988 | OPRM1 | opioid receptor mu 1 | XM_011535856.2 | 58.3% | 56.3% | (many diffs) |
| 24 | human | 4988 | OPRM1 | opioid receptor mu 1 | XM_011535862.2 | 58.3% | 56.3% | (many diffs) |
| 25 | human | 4988 | OPRM1 | opioid receptor mu 1 | XM_017010903.2 | 58.3% | 56.3% | (many diffs) |
| 26 | human | 4988 | OPRM1 | opioid receptor mu 1 | XM_017010904.1 | 58.3% | 56.3% | (many diffs) |
| 27 | human | 4988 | OPRM1 | opioid receptor mu 1 | XM_017010905.1 | 58.3% | 56.3% | (many diffs) |
| 28 | human | 4988 | OPRM1 | opioid receptor mu 1 | NR_104351.1 | 48.5% | (many diffs) | |
| 29 | human | 4988 | OPRM1 | opioid receptor mu 1 | XM_017010907.2 | 38.6% | 35.4% | (many diffs) |
| 30 | human | 4988 | OPRM1 | opioid receptor mu 1 | NM_001285522.1 | 20.8% | 20.7% | 0_1ins186;135C>T;291_291delCins911 |
| 31 | human | 4988 | OPRM1 | opioid receptor mu 1 | NR_104348.1 | 8.8% | (many diffs) | |
| 32 | human | 4988 | OPRM1 | opioid receptor mu 1 | NR_104350.1 | 6.5% | (many diffs) | |
| 33 | mouse | 18390 | Oprm1 | opioid receptor, mu 1 | NM_001302793.1 | 75.4% | 81.2% | (many diffs) |
| 34 | mouse | 18390 | Oprm1 | opioid receptor, mu 1 | NM_001304950.1 | 74% | 79% | (many diffs) |
| 35 | mouse | 18390 | Oprm1 | opioid receptor, mu 1 | NM_001304937.1 | 73.6% | 78.6% | (many diffs) |
| 36 | mouse | 18390 | Oprm1 | opioid receptor, mu 1 | NM_001304938.1 | 73.4% | 78.8% | (many diffs) |
| 37 | mouse | 18390 | Oprm1 | opioid receptor, mu 1 | XM_006512437.3 | 73% | 78.3% | (many diffs) |
| 38 | mouse | 18390 | Oprm1 | opioid receptor, mu 1 | NM_001304948.1 | 72.9% | 75.7% | (many diffs) |
| 39 | mouse | 18390 | Oprm1 | opioid receptor, mu 1 | XM_017313827.1 | 70.4% | 73.5% | (many diffs) |
| 40 | mouse | 18390 | Oprm1 | opioid receptor, mu 1 | NM_001039652.2 | 67.8% | 73.1% | (many diffs) |
| 41 | mouse | 18390 | Oprm1 | opioid receptor, mu 1 | XM_017313826.1 | 66.1% | 70.5% | (many diffs) |
| 42 | mouse | 18390 | Oprm1 | opioid receptor, mu 1 | NM_001304955.1 | 63.3% | 68.2% | (many diffs) |
| 43 | mouse | 18390 | Oprm1 | opioid receptor, mu 1 | NM_001302794.1 | 61.8% | 61.9% | (many diffs) |
| 44 | mouse | 18390 | Oprm1 | opioid receptor, mu 1 | NM_001302796.1 | 60.4% | 59.8% | (many diffs) |
| 45 | mouse | 18390 | Oprm1 | opioid receptor, mu 1 | NM_001302795.1 | 55.4% | 55.6% | (many diffs) |
| 46 | mouse | 18390 | Oprm1 | opioid receptor, mu 1 | XM_017313828.1 | 41.4% | 18.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1458
- ORF length:
- 1389
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcaccat gtcagatgct cagctcggtc ccctccgcct gacgctcctc tctgtctcag 121 ccaggactgg tttctgtaag aaacagcagg agctgtggca gcggcgaaag gaagcggctg 181 aggcgcttgg aacccgaaaa gtctcggtgc tcctggctac ctcgcacagc ggtgcccgcc 241 cggccgtcag taccatggac agcagcgctg cccccacgaa cgccagcaat tgcactgatg 301 ccttggcgta ctcaagttgc tccccagcac ccagccccgg ttcctgggtc aacttgtccc 361 acttagatgg caacctgtcc gacccatgtg gtccgaaccg caccgacctg ggcgggagag 421 acagcctgtg ccctccgacc ggcagtccct ccatgatcac ggccatcacg atcatggccc 481 tctactccat cgtgtgcgtg gtggggctct tcggaaactt cctggtcatg tatgtgattg 541 tcagatacac caagatgaag actgccacca acatctacat tttcaacctt gctctggcag 601 atgccttagc caccagtacc ctgcccttcc agagtgtgaa ttacctaatg ggaacatggc 661 catttggaac catcctttgc aagatagtga tctccataga ttactataac atgttcacca 721 gcatattcac cctctgcacc atgagtgttg atcgatacat tgcagtctgc caccctgtca 781 aggccttaga tttccgtact ccccgaaatg ccaaaattat caatgtctgc aactggatcc 841 tctcttcagc cattggtctt cctgtaatgt tcatggctac aacaaaatac aggcaaggtt 901 ccatagattg tacactaaca ttctctcatc caacctggta ctgggaaaac ctgctgaaga 961 tctgtgtttt catcttcgcc ttcattatgc cagtgctcat cattaccgtg tgctatggac 1021 tgatgatctt gcgcctcaag agtgtccgca tgctctctgg ctccaaagaa aaggacagga 1081 atcttcgaag gatcaccagg atggtgctgg tggtggtggc tgtgttcatc gtctgctgga 1141 ctcccattca catttacgtc atcattaaag ccttggttac aatcccagaa actacgttcc 1201 agactgtttc ttggcacttc tgcattgctc taggttacac aaaCAGCTGC CTCAACCCAG 1261 TCCTTTATGC ATTTCTGGAT GAAAACTTCA AACGATGCTT CAGAGAGTTC TGTATCCCAA 1321 CCTCTTCCAA CATTGAGCAA CAAAACTCCA CTCGAATTCG TCAGAACACT AGAGACCACC 1381 CCTCCACGGC CAATACAGTG GATAGAACTA ATCATCAGCT AGAAAATCTG GAAGCAGAAA 1441 CTGCTCCGTT GCCCGACCCA GCTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 1501 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 1561 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA GCCCGGGTCA CCAAGCGACC 1621 ACCGACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt