Transcript: Human NM_001305557.2

Homo sapiens thioredoxin like 4A (TXNL4A), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-09
Taxon:
Homo sapiens (human)
Gene:
TXNL4A (10907)
Length:
3448
CDS:
172..576

Additional Resources:

NCBI RefSeq record:
NM_001305557.2
NBCI Gene record:
TXNL4A (10907)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001305557.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064063 CGATCCATGTACTGTCATGTT pLKO.1 375 CDS 100% 4.950 6.930 N TXNL4A n/a
2 TRCN0000311672 CGATCCATGTACTGTCATGTT pLKO_005 375 CDS 100% 4.950 6.930 N TXNL4A n/a
3 TRCN0000064067 CAACAAGATTAACTGGGCCAT pLKO.1 444 CDS 100% 2.160 3.024 N TXNL4A n/a
4 TRCN0000311674 CAACAAGATTAACTGGGCCAT pLKO_005 444 CDS 100% 2.160 3.024 N TXNL4A n/a
5 TRCN0000064065 ACTGGCAACAACAACAAGATT pLKO.1 433 CDS 100% 5.625 3.938 N TXNL4A n/a
6 TRCN0000311673 ACTGGCAACAACAACAAGATT pLKO_005 433 CDS 100% 5.625 3.938 N TXNL4A n/a
7 TRCN0000064064 CAAGGACTACTCCACCAAGTA pLKO.1 546 CDS 100% 4.950 3.465 N TXNL4A n/a
8 TRCN0000311675 CAAGGACTACTCCACCAAGTA pLKO_005 546 CDS 100% 4.950 3.465 N TXNL4A n/a
9 TRCN0000064066 GCAGTTATTTATCTTGTGGAT pLKO.1 313 CDS 100% 2.640 1.848 N TXNL4A n/a
10 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 1518 3UTR 100% 4.950 2.475 Y CFLAR n/a
11 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 1518 3UTR 100% 4.950 2.475 Y C19orf31 n/a
12 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2652 3UTR 100% 13.200 6.600 Y LIAS n/a
13 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 1682 3UTR 100% 10.800 5.400 Y SMIM11A n/a
14 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 1516 3UTR 100% 4.950 2.475 Y ERN2 n/a
15 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 1516 3UTR 100% 4.950 2.475 Y P3H4 n/a
16 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 1516 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001305557.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02555 pDONR223 100% 94.3% 94.3% None 127_128ins24 n/a
2 ccsbBroad304_02555 pLX_304 0% 94.3% 94.3% V5 127_128ins24 n/a
3 TRCN0000467428 ACCCGCCTCTGCCGCGGTAATACA pLX_317 73.9% 94.3% 94.3% V5 127_128ins24 n/a
Download CSV