Transcript: Human NM_001308020.2

Homo sapiens phosphatidylinositol 3-kinase catalytic subunit type 3 (PIK3C3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
PIK3C3 (5289)
Length:
9226
CDS:
59..2533

Additional Resources:

NCBI RefSeq record:
NM_001308020.2
NBCI Gene record:
PIK3C3 (5289)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001308020.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000196840 GAGATGTACTTGAACGTAATG pLKO.1 1412 CDS 100% 10.800 15.120 N PIK3C3 n/a
2 TRCN0000296101 GAGATGTACTTGAACGTAATG pLKO_005 1412 CDS 100% 10.800 15.120 N PIK3C3 n/a
3 TRCN0000037796 CGAAGGTATTCTAATCTGATT pLKO.1 2297 CDS 100% 4.950 6.930 N PIK3C3 n/a
4 TRCN0000037797 CGGTGATGAATCATCTCCAAT pLKO.1 586 CDS 100% 4.950 3.960 N PIK3C3 n/a
5 TRCN0000037794 CCACGAGAGATCAGTTAAATA pLKO.1 741 CDS 100% 15.000 10.500 N PIK3C3 n/a
6 TRCN0000196290 GAGGCAAATATCCAGTTATAT pLKO.1 1752 CDS 100% 15.000 10.500 N PIK3C3 n/a
7 TRCN0000196708 GCTGGATAGATTGACATTTAG pLKO.1 445 CDS 100% 13.200 9.240 N PIK3C3 n/a
8 TRCN0000296151 GCTGGATAGATTGACATTTAG pLKO_005 445 CDS 100% 13.200 9.240 N PIK3C3 n/a
9 TRCN0000037795 CCAAGTGAGAATGGGCCAAAT pLKO.1 1994 CDS 100% 10.800 7.560 N PIK3C3 n/a
10 TRCN0000289015 CCAAGTGAGAATGGGCCAAAT pLKO_005 1994 CDS 100% 10.800 7.560 N PIK3C3 n/a
11 TRCN0000037798 GCTGCACAACAGACATTTGTA pLKO.1 1496 CDS 100% 5.625 3.938 N PIK3C3 n/a
12 TRCN0000196247 GCAACCTTTGTATATTGGAGA pLKO.1 2587 3UTR 100% 2.640 1.848 N PIK3C3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001308020.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491942 CCTATCCGGCCGAGTTACGAGTCC pLX_317 14.6% 92.8% 92.8% V5 (not translated due to prior stop codon) 68_69ins189;1224G>C;1227A>G n/a
2 ccsbBroadEn_14758 pDONR223 60.7% 92.4% 14.2% None (many diffs) n/a
3 ccsbBroad304_14758 pLX_304 0% 92.4% 14.2% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000475007 AATCTTGGTAACTGTATGAATAAA pLX_317 19% 92.4% 14.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV