Transcript: Mouse NM_001311111.1

Mus musculus thiamine pyrophosphokinase (Tpk1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Tpk1 (29807)
Length:
2531
CDS:
159..743

Additional Resources:

NCBI RefSeq record:
NM_001311111.1
NBCI Gene record:
Tpk1 (29807)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001311111.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000361622 AGCTGTATTGTATGGCTAATA pLKO_005 1050 3UTR 100% 13.200 18.480 N Tpk1 n/a
2 TRCN0000025561 CACTTATATGATCTCACTGAA pLKO.1 309 CDS 100% 4.950 6.930 N Tpk1 n/a
3 TRCN0000025563 GATGCACGATTTCGCCATCTT pLKO.1 243 CDS 100% 4.950 6.930 N Tpk1 n/a
4 TRCN0000274739 AGAAGGGCTGTGATCTTATTT pLKO_005 412 CDS 100% 15.000 12.000 N Tpk1 n/a
5 TRCN0000274738 ATTCCAGGTAATGCTATAAAT pLKO_005 978 3UTR 100% 15.000 10.500 N Tpk1 n/a
6 TRCN0000361621 ATACTGCCTTGTGGTTCTTAA pLKO_005 212 CDS 100% 13.200 9.240 N Tpk1 n/a
7 TRCN0000361620 CAGCCTTTGGATGCACGATTT pLKO_005 234 CDS 100% 10.800 7.560 N Tpk1 n/a
8 TRCN0000025560 CCTGAAATGGAACCTCACAAA pLKO.1 608 CDS 100% 4.950 3.465 N Tpk1 n/a
9 TRCN0000274740 CCTGAAATGGAACCTCACAAA pLKO_005 608 CDS 100% 4.950 3.465 N Tpk1 n/a
10 TRCN0000025559 GCCTGAAGTCAAAGAGTACTA pLKO.1 386 CDS 100% 4.950 3.465 N Tpk1 n/a
11 TRCN0000274678 GCCTGAAGTCAAAGAGTACTA pLKO_005 386 CDS 100% 4.950 3.465 N Tpk1 n/a
12 TRCN0000025562 TGTGGTTCTTAATCAGCCTTT pLKO.1 221 CDS 100% 4.050 2.835 N Tpk1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001311111.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11838 pDONR223 100% 70% 70.7% None (many diffs) n/a
2 ccsbBroad304_11838 pLX_304 0% 70% 70.7% V5 (many diffs) n/a
3 TRCN0000470689 CAACATTATCCATTCCACCATCGT pLX_317 56.2% 70% 70.7% V5 (many diffs) n/a
4 ccsbBroadEn_15039 pDONR223 0% 70% 70.7% None (many diffs) n/a
5 ccsbBroad304_15039 pLX_304 0% 70% 70.7% V5 (many diffs) n/a
6 TRCN0000480139 CATTGGTCGATGTTTAGTACGTCG pLX_317 57% 70% 70.7% V5 (many diffs) n/a
7 TRCN0000489639 ATTGATGTCTGGGAAGTCTCCCAC pLX_317 56.9% 70% 70.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV