Transcript: Mouse NM_001311157.1

Mus musculus ubiquitin specific peptidase 4 (proto-oncogene) (Usp4), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Mus musculus (mouse)
Gene:
Usp4 (22258)
Length:
3559
CDS:
88..2835

Additional Resources:

NCBI RefSeq record:
NM_001311157.1
NBCI Gene record:
Usp4 (22258)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001311157.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000295779 ATGTTAAGAGGCTGGATTATT pLKO_005 3004 3UTR 100% 15.000 21.000 N Usp4 n/a
2 TRCN0000295778 GGCTTCTCTGCTTCGTATAAT pLKO_005 790 CDS 100% 15.000 21.000 N Usp4 n/a
3 TRCN0000030743 GCCTGGAATAAATTGCTGAAT pLKO.1 385 CDS 100% 4.950 3.960 N Usp4 n/a
4 TRCN0000288458 GCCTGGAATAAATTGCTGAAT pLKO_005 385 CDS 100% 4.950 3.960 N Usp4 n/a
5 TRCN0000030741 GCCTTATGTTTATGACCTAAT pLKO.1 2526 CDS 100% 10.800 7.560 N Usp4 n/a
6 TRCN0000288534 GCCTTATGTTTATGACCTAAT pLKO_005 2526 CDS 100% 10.800 7.560 N Usp4 n/a
7 TRCN0000030739 CCCGGTTATGAAATGAAGTTA pLKO.1 3375 3UTR 100% 5.625 3.938 N Usp4 n/a
8 TRCN0000030742 CCAGGCTGTTTGTGATCGTAT pLKO.1 1806 CDS 100% 4.950 3.465 N Usp4 n/a
9 TRCN0000030740 CCGCGTAAAGAAGAAGCCTTA pLKO.1 1176 CDS 100% 4.050 2.835 N Usp4 n/a
10 TRCN0000288460 CCGCGTAAAGAAGAAGCCTTA pLKO_005 1176 CDS 100% 4.050 2.835 N Usp4 n/a
11 TRCN0000004038 CATGTCCGAGTTTGTCTGTAA pLKO.1 2493 CDS 100% 4.950 3.465 N USP4 n/a
12 TRCN0000320391 CATGTCCGAGTTTGTCTGTAA pLKO_005 2493 CDS 100% 4.950 3.465 N USP4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001311157.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15618 pDONR223 0% 83.2% 86.2% None (many diffs) n/a
2 ccsbBroad304_15618 pLX_304 0% 83.2% 86.2% V5 (many diffs) n/a
3 ccsbBroadEn_07120 pDONR223 100% 83.2% 86.3% None (many diffs) n/a
4 ccsbBroad304_07120 pLX_304 0% 83.2% 86.3% V5 (many diffs) n/a
5 TRCN0000477449 TCACTTTTTTCGGCACCCACGTTC pLX_317 14.6% 83.2% 86.3% V5 (many diffs) n/a
Download CSV