Transcript: Mouse NM_001312906.1

Mus musculus hepatic nuclear factor 4, alpha (Hnf4a), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Hnf4a (15378)
Length:
4393
CDS:
228..1577

Additional Resources:

NCBI RefSeq record:
NM_001312906.1
NBCI Gene record:
Hnf4a (15378)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001312906.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000340613 ACAGACGTGTGTGAGTCTATG pLKO_005 705 CDS 100% 10.800 15.120 N Hnf4a n/a
2 TRCN0000365819 GTGTCGTTACTGCAGGCTTAA pLKO_005 485 CDS 100% 10.800 15.120 N Hnf4a n/a
3 TRCN0000026154 CGACAATGTGTGGTAGACAAA pLKO.1 450 CDS 100% 4.950 6.930 N Hnf4a n/a
4 TRCN0000365892 GACAATGTGTGGTAGACAAAG pLKO_005 451 CDS 100% 10.800 8.640 N Hnf4a n/a
5 TRCN0000365888 TCGGGATCTGAATCCTACAAG pLKO_005 1473 CDS 100% 4.950 3.960 N Hnf4a n/a
6 TRCN0000365890 CCAAGAGGTCCATGGTGTTTA pLKO_005 850 CDS 100% 13.200 9.240 N Hnf4a n/a
7 TRCN0000026216 GCAGATTGATGACAATGAATA pLKO.1 989 CDS 100% 13.200 9.240 N Hnf4a n/a
8 TRCN0000340691 GCAGATTGATGACAATGAATA pLKO_005 989 CDS 100% 13.200 9.240 N Hnf4a n/a
9 TRCN0000365891 ACATGGGCACCAATGTCATTG pLKO_005 1342 CDS 100% 10.800 7.560 N Hnf4a n/a
10 TRCN0000365893 CATGTACTCCTGCAGGTTTAG pLKO_005 428 CDS 100% 10.800 7.560 N Hnf4a n/a
11 TRCN0000365818 CTGGGATCAATGGCGACATTC pLKO_005 661 CDS 100% 10.800 7.560 N Hnf4a n/a
12 TRCN0000365822 GCAAGTGAGCCTGGAGGATTA pLKO_005 1097 CDS 100% 10.800 7.560 N Hnf4a n/a
13 TRCN0000364314 TCTTCGGCATGGCCAAGATTG pLKO_005 1231 CDS 100% 10.800 7.560 N HNF4A n/a
14 TRCN0000026158 CGAACAGATCCAGTTCATCAA pLKO.1 1208 CDS 100% 4.950 3.465 N Hnf4a n/a
15 TRCN0000340612 CGAACAGATCCAGTTCATCAA pLKO_005 1208 CDS 100% 4.950 3.465 N Hnf4a n/a
16 TRCN0000026213 GCACCAATGTCATTGTTGCTA pLKO.1 1348 CDS 100% 3.000 2.100 N Hnf4a n/a
17 TRCN0000026149 CCTCAATTCATCCAACAGCCT pLKO.1 293 CDS 100% 0.660 0.462 N Hnf4a n/a
18 TRCN0000340610 CCTCAATTCATCCAACAGCCT pLKO_005 293 CDS 100% 0.660 0.462 N Hnf4a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001312906.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488427 CAGAGGCTTCAAGGCCATACACCA pLX_317 24.5% 83.9% 88.3% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000491796 TTGAAGTTAAAGATCCTGTCCCTC pLX_317 24.3% 83.8% 88.2% V5 (many diffs) n/a
3 TRCN0000489372 CTCACCGCTACATTCTGCATATCG pLX_317 14.2% 70.7% 70.4% V5 (many diffs) n/a
4 ccsbBroadEn_00763 pDONR223 100% 69.6% 70.4% None (many diffs) n/a
5 ccsbBroad304_00763 pLX_304 0% 69.6% 70.4% V5 (many diffs) n/a
6 TRCN0000476469 AGCACACTGACAGTATAACCGGAG pLX_317 31.1% 69.6% 70.4% V5 (many diffs) n/a
7 TRCN0000489601 TACTGCCAAGAATCGACTGATGGC pLX_317 24.1% 69.6% 70.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV