Transcript: Human NM_001316961.1

Homo sapiens adipogenesis associated Mth938 domain containing (AAMDC), transcript variant 5, mRNA.

Source:
NCBI, updated 2018-07-01
Taxon:
Homo sapiens (human)
Gene:
AAMDC (28971)
Length:
608
CDS:
185..553

Additional Resources:

NCBI RefSeq record:
NM_001316961.1
NBCI Gene record:
AAMDC (28971)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001316961.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263812 AGGCTCTAATACAACCTATAA pLKO_005 235 CDS 100% 13.200 18.480 N AAMDC n/a
2 TRCN0000263814 GTGTACAGACTCTTGTGATTG pLKO_005 366 CDS 100% 10.800 7.560 N AAMDC n/a
3 TRCN0000263816 CAAGAAACATGGCATTGATGT pLKO_005 439 CDS 100% 4.950 3.465 N AAMDC n/a
4 TRCN0000263813 CAGATGTGAAGGAAGTTGTTG pLKO_005 339 CDS 100% 4.950 3.465 N AAMDC n/a
5 TRCN0000168735 GAGAAACAGGAACTGAGCATT pLKO.1 300 CDS 100% 4.950 3.465 N AAMDC n/a
6 TRCN0000172861 GAAGGTGCCTTCATCAACTGT pLKO.1 409 CDS 100% 3.000 2.100 N AAMDC n/a
7 TRCN0000263815 AGTCGGACTTGGGATTGGAGA pLKO_005 281 CDS 100% 2.640 1.848 N AAMDC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001316961.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03049 pDONR223 100% 100% 100% None n/a
2 ccsbBroadEn_11889 pDONR223 100% 69.6% 63.1% None (many diffs) n/a
3 ccsbBroad304_11889 pLX_304 0% 69.6% 63.1% V5 (many diffs) n/a
4 TRCN0000465280 CAGTTCAGCTACACACAGTAATTT pLX_317 100% 69.6% 63.1% V5 (many diffs) n/a
Download CSV