Transcript: Human NM_001317815.1

Homo sapiens tripartite motif containing 74 (TRIM74), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-07-01
Taxon:
Homo sapiens (human)
Gene:
TRIM74 (378108)
Length:
1341
CDS:
140..892

Additional Resources:

NCBI RefSeq record:
NM_001317815.1
NBCI Gene record:
TRIM74 (378108)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001317815.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221031 GTGCTGGAACAGTTCGGAAAT pLKO.1 821 CDS 100% 10.800 6.480 N TRIM74 n/a
2 TRCN0000151048 GTTCACTCAAGCTACAGAAAT pLKO.1 1118 3UTR 100% 13.200 6.600 Y TRIM73 n/a
3 TRCN0000439102 GGTCTTCAAGGAGTCCCTAAT pLKO_005 202 CDS 100% 10.800 5.400 Y TRIM73 n/a
4 TRCN0000439956 GGTTCCTCCATTCAGCTTAAC pLKO_005 955 3UTR 100% 10.800 5.400 Y TRIM73 n/a
5 TRCN0000437707 AGAAGGACCAGGAGCTCATCT pLKO_005 441 CDS 100% 4.950 2.475 Y TRIM74 n/a
6 TRCN0000221029 CCATGAGTTCATCTGGAAGTT pLKO.1 850 CDS 100% 4.950 2.475 Y TRIM74 n/a
7 TRCN0000221030 CGTCAATGAGTCGGATGTCTT pLKO.1 631 CDS 100% 4.950 2.475 Y TRIM74 n/a
8 TRCN0000221033 CTCATCGCCAAACTGGTGAAA pLKO.1 596 CDS 100% 4.950 2.475 Y TRIM74 n/a
9 TRCN0000221032 AGGTCTTCAAGGAGTCCCTAA pLKO.1 201 CDS 100% 4.050 2.025 Y TRIM74 n/a
10 TRCN0000447198 ATCGTCAATGAGTCGGATGTC pLKO_005 629 CDS 100% 4.050 2.025 Y TRIM73 n/a
11 TRCN0000152437 CAGAAATACTAGAGGAGGGTA pLKO.1 1132 3UTR 100% 2.640 1.320 Y TRIM73 n/a
12 TRCN0000180127 CATCTGGAAGTTCCACTCCAT pLKO.1 859 CDS 100% 2.640 1.320 Y TRIM73 n/a
13 TRCN0000180153 CCACCATGAGTTCATCTGGAA pLKO.1 847 CDS 100% 2.640 1.320 Y TRIM73 n/a
14 TRCN0000007785 CGAATCGTCAATGAGTCGGAT pLKO.1 626 CDS 100% 2.640 1.320 Y TRIM50 n/a
15 TRCN0000007787 GCTTCAGTGTCCCATCTGCCT pLKO.1 178 CDS 100% 0.220 0.110 Y TRIM50 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001317815.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13639 pDONR223 100% 99.2% 98.4% None (many diffs) n/a
2 ccsbBroad304_13639 pLX_304 0% 99.2% 98.4% V5 (many diffs) n/a
3 TRCN0000481047 GACCCCCTCAGCAAATCTAACTCG pLX_317 55.8% 99.2% 98.4% V5 (many diffs) n/a
4 ccsbBroadEn_09564 pDONR223 100% 49.2% 47.6% None (many diffs) n/a
5 ccsbBroad304_09564 pLX_304 0% 49.2% 47.6% V5 (many diffs) n/a
6 TRCN0000476413 GCAGATCCGACACGTTAAGGCGTT pLX_317 20.6% 49.2% 47.6% V5 (many diffs) n/a
Download CSV