Transcript: Human NM_001318029.2

Homo sapiens cholecystokinin B receptor (CCKBR), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
CCKBR (887)
Length:
1767
CDS:
92..1183

Additional Resources:

NCBI RefSeq record:
NM_001318029.2
NBCI Gene record:
CCKBR (887)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001318029.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000005902 CGTCCCTAGCAGTGAACTATT pLKO.1 1438 3UTR 100% 13.200 18.480 N CCKBR n/a
2 TRCN0000356409 GTCCCTAGCAGTGAACTATTT pLKO_005 1439 3UTR 100% 13.200 18.480 N CCKBR n/a
3 TRCN0000368612 GTGTTGGTTGCCAGTTTATAG pLKO_005 871 CDS 100% 13.200 18.480 N CCKBR n/a
4 TRCN0000356349 CTCTCACACACATAGATTAAT pLKO_005 1495 3UTR 100% 15.000 10.500 N CCKBR n/a
5 TRCN0000005904 GCTTCTGCTCTTGTTCTTCAT pLKO.1 505 CDS 100% 4.950 3.465 N CCKBR n/a
6 TRCN0000005903 CGAATGTTGCTGGTGATCGTT pLKO.1 836 CDS 100% 3.000 2.100 N CCKBR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001318029.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05945 pDONR223 100% 81.1% 81.2% None 150_151ins252;171C>T n/a
2 ccsbBroad304_05945 pLX_304 0% 81.1% 81.2% V5 150_151ins252;171C>T n/a
3 TRCN0000467911 ACTGGCAAGCTCCACCCTGCATCA pLX_317 21.8% 81.1% 81.2% V5 150_151ins252;171C>T n/a
4 TRCN0000489736 CATATCTTAGGAAGGAATTCTCAA pLX_317 30.3% 81.1% 80.9% V5 (not translated due to prior stop codon) 150_151ins252;365T>C n/a
5 TRCN0000489791 GGGGCTCAAACATGTTCATGTGAC pLX_317 28.8% 81% 80.8% V5 150_151ins252;365T>C;1089_1090insG n/a
Download CSV