Construct: ORF TRCN0000467911
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009927.1_s317c1
- Derived from:
- ccsbBroadEn_05945
- DNA Barcode:
- ACTGGCAAGCTCCACCCTGCATCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CCKBR (887)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467911
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 887 | CCKBR | cholecystokinin B receptor | NM_176875.4 | 99.9% | 100% | 423C>T |
2 | human | 887 | CCKBR | cholecystokinin B receptor | NM_001363552.2 | 86.5% | 86.6% | 423C>T;809_1015del |
3 | human | 887 | CCKBR | cholecystokinin B receptor | XM_017018516.1 | 85.1% | 85.2% | 0_1ins198;225C>T |
4 | human | 887 | CCKBR | cholecystokinin B receptor | NM_001318029.2 | 81.1% | 81.2% | 150_151ins252;171C>T |
5 | mouse | 12426 | Cckbr | cholecystokinin B receptor | NM_007627.5 | 83.9% | 87.6% | (many diffs) |
6 | mouse | 12426 | Cckbr | cholecystokinin B receptor | XM_006507280.3 | 83.8% | 87.4% | (many diffs) |
7 | mouse | 12426 | Cckbr | cholecystokinin B receptor | XM_006507281.3 | 48.3% | 50.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1407
- ORF length:
- 1341
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga gctgctaaag ctgaaccgga gcgtgcaggg aaccggaccc gggccggggg 121 cttccctgtg ccgcccgggg gcgcctctcc tcaacagcag cagtgtgggc aacctcagct 181 gcgagccccc tcgcattcgc ggagccggga cacgagaatt ggagctggcc attagaatca 241 ctctttacgc agtgatcttc ctgatgagcg ttggaggaaa tatgctcatc atcgtggtcc 301 tgggactgag ccgccgcctg aggactgtca ccaatgcctt cctcctctca ctggcagtca 361 gcgacctcct gctggctgtg gcttgcatgc ccttcaccct cctgcccaat ctcatgggca 421 cattcatctt tggcaccgtc atctgcaagg cggtttccta cctcatgggg gtgtctgtga 481 gtgtgtctac gctaagcctc gtggccatcg cactggagcg gtacagcgcc atctgccgac 541 cactgcaggc acgagtgtgg cagacgcgct cccacgcggc tcgcgtgatt gtagccacgt 601 ggctgctgtc cggactactc atggtgccct accccgtgta cactgtcgtg caaccagtgg 661 ggcctcgtgt gctgcagtgc gtgcatcgct ggcccagtgc gcgggtccgc cagacctggt 721 ccgtactgct gcttctgctc ttgttcttca tcccgggtgt ggttatggcc gtggcctacg 781 ggcttatctc tcgcgagctc tacttagggc ttcgctttga cggcgacagt gacagcgaca 841 gccaaagcag ggtccgaaac caaggcgggc tgccaggggc tgttcaccag aacgggcgtt 901 gccggcctga gactggcgcg gttggcgaag acagcgatgg ctgctacgtg caacttccac 961 gttcccggcc tgccctggag ctgacggcgc tgacggctcc tgggccggga tccggctccc 1021 ggcccaccca ggccaagctg ctggctaaga agcgcgtggt gcgaatgttg ctggtgatcg 1081 ttgtgctttt ttttctgtgt tggttgccag tttatagtgc CAACACGTGG CGCGCCTTTG 1141 ATGGCCCGGG TGCACACCGA GCACTCTCGG GTGCTCCTAT CTCCTTCATT CACTTGCTGA 1201 GCTACGCCTC GGCCTGTGTC AACCCCCTGG TCTACTGCTT CATGCACCGT CGCTTTCGCC 1261 AGGCCTGCCT GGAAACTTGC GCTCGCTGCT GCCCCCGGCC TCCACGAGCT CGCCCCAGGG 1321 CTCTTCCCGA TGAGGACCCT CCCACTCCCT CCATTGCTTC GCTGTCCAGG CTTAGCTACA 1381 CCACCATCAG CACACTGGGC CCTGGCTGCC CAACTTTCTT GTACAAAGTG GTTGATATCG 1441 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 1501 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GAACTGGCAA 1561 GCTCCACCCT GCATCAACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 1621 aagatt