Transcript: Human NM_001318202.2

Homo sapiens formin homology 2 domain containing 1 (FHOD1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
FHOD1 (29109)
Length:
3891
CDS:
72..3644

Additional Resources:

NCBI RefSeq record:
NM_001318202.2
NBCI Gene record:
FHOD1 (29109)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001318202.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000258004 GACAGCATGGAGCGGGAAATT pLKO_005 2520 CDS 100% 13.200 9.240 N FHOD1 n/a
2 TRCN0000250144 TCTACGAGAACGCCCTGAAAT pLKO_005 1057 CDS 100% 13.200 9.240 N FHOD1 n/a
3 TRCN0000250143 AGGTGCTGTATCCCGGAAATC pLKO_005 3645 CDS 100% 10.800 7.560 N FHOD1 n/a
4 TRCN0000250145 TGAGTCCTCTGACCTCTATTC pLKO_005 2765 CDS 100% 10.800 7.560 N FHOD1 n/a
5 TRCN0000258009 TGGCCCACAGTGACACTATTC pLKO_005 664 CDS 100% 10.800 7.560 N FHOD1 n/a
6 TRCN0000127811 GAAATTGCTGAGCCACTGTTT pLKO.1 2535 CDS 100% 4.950 3.465 N FHOD1 n/a
7 TRCN0000131116 GAAATCTATCTGGACCCTGGA pLKO.1 3660 3UTR 100% 2.160 1.512 N FHOD1 n/a
8 TRCN0000149159 GCCTGAATTTGTGCATTCAGA pLKO.1 530 CDS 100% 0.300 0.210 N FHOD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001318202.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08115 pDONR223 100% 97.7% 97.8% None 1319_1396del;2556G>T n/a
2 ccsbBroad304_08115 pLX_304 0% 97.7% 97.8% V5 1319_1396del;2556G>T n/a
3 TRCN0000481039 TACATGCCACTTTCTCCCTTTAGG pLX_317 10.5% 97.7% 97.8% V5 1319_1396del;2556G>T n/a
Download CSV