Transcript: Human NM_001318500.2

Homo sapiens mitochondrial ribosomal protein L48 (MRPL48), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
MRPL48 (51642)
Length:
1227
CDS:
99..464

Additional Resources:

NCBI RefSeq record:
NM_001318500.2
NBCI Gene record:
MRPL48 (51642)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001318500.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240819 ACTTCAAGGGACGATTCAAAG pLKO_005 403 CDS 100% 10.800 8.640 N MRPL48 n/a
2 TRCN0000240817 GCCTGAGGAACAATACCATTT pLKO_005 127 CDS 100% 10.800 8.640 N MRPL48 n/a
3 TRCN0000180011 CCACGGCATTGGAAAGTACAA pLKO.1 257 CDS 100% 4.950 3.960 N MRPL48 n/a
4 TRCN0000179227 GAAGAGCTTACTGGGTAGTTA pLKO.1 514 3UTR 100% 5.625 3.938 N MRPL48 n/a
5 TRCN0000240820 CATGCCAGCAGTGGTCATATT pLKO_005 481 3UTR 100% 13.200 7.920 N MRPL48 n/a
6 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1142 3UTR 100% 5.625 2.813 Y KLHL30 n/a
7 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1142 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001318500.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08333 pDONR223 100% 56.7% 56.1% None 17A>G;199_200ins273;344A>C n/a
2 ccsbBroad304_08333 pLX_304 0% 56.7% 56.1% V5 17A>G;199_200ins273;344A>C n/a
3 TRCN0000470218 ACGCCGTTTGAACGGCTAGCTGTA pLX_317 77.5% 56.7% 56.1% V5 17A>G;199_200ins273;344A>C n/a
Download CSV