Transcript: Human NM_001318939.2

Homo sapiens EEF1A lysine methyltransferase 1 (EEF1AKMT1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
EEF1AKMT1 (221143)
Length:
1054
CDS:
61..705

Additional Resources:

NCBI RefSeq record:
NM_001318939.2
NBCI Gene record:
EEF1AKMT1 (221143)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001318939.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000145142 GCAAATGAGTTTCGCTGTTAT pLKO.1 649 CDS 100% 13.200 18.480 N EEF1AKMT1 n/a
2 TRCN0000139898 GCACGTTTGTTCCAAGACACA pLKO.1 617 CDS 100% 2.640 3.696 N EEF1AKMT1 n/a
3 TRCN0000122562 CCCGAAAGAATTGCTGCACAT pLKO.1 439 CDS 100% 4.050 3.240 N EEF1AKMT1 n/a
4 TRCN0000138989 CTTTCGGAGGAATGTCTCAGA pLKO.1 493 CDS 100% 2.640 2.112 N EEF1AKMT1 n/a
5 TRCN0000424543 ATGTATGGAGAGGAGTTTATT pLKO_005 388 CDS 100% 15.000 10.500 N EEF1AKMT1 n/a
6 TRCN0000122732 CCAGGCGAGGATGATAAATAT pLKO.1 157 CDS 100% 15.000 10.500 N EEF1AKMT1 n/a
7 TRCN0000419477 GAGTGAAGATGTGCACGTTTG pLKO_005 605 CDS 100% 6.000 4.200 N EEF1AKMT1 n/a
8 TRCN0000139353 CCGGAACTTGGCAAATGAGTT pLKO.1 639 CDS 100% 4.950 3.465 N EEF1AKMT1 n/a
9 TRCN0000416042 ATGATTACAATAATCCATTGG pLKO_005 413 CDS 100% 4.050 2.835 N EEF1AKMT1 n/a
10 TRCN0000139966 GAATTGGCAACTGAGCCAGTT pLKO.1 198 CDS 100% 4.050 2.835 N EEF1AKMT1 n/a
11 TRCN0000140564 GACGGTGACATAACACAGGAA pLKO.1 711 3UTR 100% 2.640 1.848 N EEF1AKMT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001318939.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05251 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05251 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473875 CCACTCATGAAATTTCGTGCTTTA pLX_317 59.8% 100% 100% V5 n/a
Download CSV