Transcript: Human NM_001318975.1

Homo sapiens branched chain keto acid dehydrogenase E1 subunit beta (BCKDHB), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
BCKDHB (594)
Length:
3541
CDS:
89..1057

Additional Resources:

NCBI RefSeq record:
NM_001318975.1
NBCI Gene record:
BCKDHB (594)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001318975.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236122 GCTACTGCCATTGCGGAAATT pLKO_005 299 CDS 100% 13.200 18.480 N BCKDHB n/a
2 TRCN0000236120 TACCGGTGTAGATGCTATATT pLKO_005 2852 3UTR 100% 0.000 0.000 N BCKDHB n/a
3 TRCN0000236119 CATTGATCTGAGGACTATAAT pLKO_005 781 CDS 100% 15.000 12.000 N BCKDHB n/a
4 TRCN0000236121 GAACCTAGAGGCTCCTATATC pLKO_005 931 CDS 100% 13.200 10.560 N BCKDHB n/a
5 TRCN0000028438 CCTTGGGATGTGGACACAATT pLKO.1 803 CDS 100% 13.200 9.240 N BCKDHB n/a
6 TRCN0000236118 TGATCAACTATTGACCATATA pLKO_005 1044 CDS 100% 13.200 9.240 N BCKDHB n/a
7 TRCN0000028406 CCATTCTACATCCCAGACAAA pLKO.1 995 CDS 100% 4.950 3.465 N BCKDHB n/a
8 TRCN0000028459 CGGAAATTCAGTTTGCAGATT pLKO.1 312 CDS 100% 4.950 3.465 N BCKDHB n/a
9 TRCN0000028468 GAGGAATGTTTCTTGAACCTA pLKO.1 917 CDS 100% 3.000 2.100 N BCKDHB n/a
10 TRCN0000028471 CCAGTCTGTAACAAGTGCCTT pLKO.1 100 CDS 100% 2.640 1.584 N BCKDHB n/a
11 TRCN0000204533 CCTCCCAAAGTGCTGGAATTA pLKO.1 1852 3UTR 100% 13.200 6.600 Y LRRC74B n/a
12 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1515 3UTR 100% 5.625 2.813 Y KLHL30 n/a
13 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1515 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001318975.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00154 pDONR223 100% 82.1% 82.1% None 0_1ins210 n/a
2 ccsbBroad304_00154 pLX_304 0% 82.1% 82.1% V5 0_1ins210 n/a
3 TRCN0000470199 GCAAAAATGCCGAGCGGATATGCC pLX_317 29.5% 82.1% 82.1% V5 0_1ins210 n/a
Download CSV