Transcript: Human NM_001320589.2

Homo sapiens acylphosphatase 2 (ACYP2), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
ACYP2 (98)
Length:
952
CDS:
85..297

Additional Resources:

NCBI RefSeq record:
NM_001320589.2
NBCI Gene record:
ACYP2 (98)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001320589.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051161 CGCATTGACCGCACAAACTTT pLKO.1 377 3UTR 100% 5.625 7.875 N ACYP2 n/a
2 TRCN0000299072 CGCATTGACCGCACAAACTTT pLKO_005 377 3UTR 100% 5.625 7.875 N ACYP2 n/a
3 TRCN0000051160 GCAAGGTTGGAAGCCCTAGTT pLKO.1 354 3UTR 100% 4.950 3.960 N ACYP2 n/a
4 TRCN0000299073 GCAAGGTTGGAAGCCCTAGTT pLKO_005 354 3UTR 100% 4.950 3.960 N ACYP2 n/a
5 TRCN0000051162 TGCTTCAGAATGTATACAGAA pLKO.1 148 CDS 100% 4.950 3.465 N ACYP2 n/a
6 TRCN0000051159 TGGGTGAAGAATACCAGCAAA pLKO.1 199 CDS 100% 4.950 3.465 N ACYP2 n/a
7 TRCN0000299074 TGGGTGAAGAATACCAGCAAA pLKO_005 199 CDS 100% 4.950 3.465 N ACYP2 n/a
8 TRCN0000051158 GCAGGGTGTTTGCTTCAGAAT pLKO.1 138 CDS 100% 4.950 2.970 N ACYP2 n/a
9 TRCN0000310363 GCAGGGTGTTTGCTTCAGAAT pLKO_005 138 CDS 100% 4.950 2.970 N ACYP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001320589.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00022 pDONR223 100% 67.4% 64.6% None (many diffs) n/a
2 ccsbBroad304_00022 pLX_304 0% 67.4% 64.6% V5 (many diffs) n/a
3 TRCN0000468242 CAGTAAACTCTCTAACCCTGTTCC pLX_317 100% 67.4% 64.6% V5 (many diffs) n/a
4 TRCN0000489881 TCTTCAAACTGACCCGGTAAGATC pLX_317 100% 67.4% 64.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV