Transcript: Human NM_001320600.1

Homo sapiens centrosomal protein 70 (CEP70), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
CEP70 (80321)
Length:
1071
CDS:
161..799

Additional Resources:

NCBI RefSeq record:
NM_001320600.1
NBCI Gene record:
CEP70 (80321)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001320600.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000141646 CAACGAGCTAATGACTTGGAA pLKO.1 488 CDS 100% 3.000 4.200 N CEP70 n/a
2 TRCN0000121915 CAGGAGCTTATAGAAACTAAT pLKO.1 413 CDS 100% 13.200 9.240 N CEP70 n/a
3 TRCN0000144592 GAACATGATACAGGAGCTTAT pLKO.1 403 CDS 100% 10.800 7.560 N CEP70 n/a
4 TRCN0000142363 GAACGGAGCAAGAAGAAACTA pLKO.1 654 CDS 100% 5.625 3.938 N CEP70 n/a
5 TRCN0000141119 CCAATCAAGAACAACGAGCTA pLKO.1 477 CDS 100% 2.640 1.848 N CEP70 n/a
6 TRCN0000422492 ATTGATGATGCATGGCTTAAA pLKO_005 265 CDS 100% 13.200 7.920 N CEP70 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001320600.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12693 pDONR223 100% 99.8% 99.5% None 404G>A n/a
2 ccsbBroad304_12693 pLX_304 0% 99.8% 99.5% V5 404G>A n/a
3 TRCN0000473965 TCACACCATTCCACAGGCAGCGCA pLX_317 92.2% 99.8% 99.5% V5 404G>A n/a
4 ccsbBroadEn_09028 pDONR223 100% 35.3% 35.7% None 404G>A;462A>G;636_637ins1155 n/a
5 ccsbBroad304_09028 pLX_304 0% 35.3% 35.7% V5 (not translated due to prior stop codon) 404G>A;462A>G;636_637ins1155 n/a
6 TRCN0000467975 AAATTTTCATGCAATATTGAGCCA pLX_317 23.2% 35.3% 35.7% V5 (not translated due to prior stop codon) 404G>A;462A>G;636_637ins1155 n/a
Download CSV