Transcript: Human NM_001320758.2

Homo sapiens 5-hydroxytryptamine receptor 2B (HTR2B), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
HTR2B (3357)
Length:
1787
CDS:
181..1500

Additional Resources:

NCBI RefSeq record:
NM_001320758.2
NBCI Gene record:
HTR2B (3357)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001320758.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000014486 CCGATATATCACCTGCAATTA pLKO.1 1230 CDS 100% 13.200 10.560 N HTR2B n/a
2 TRCN0000358285 TGCCATTCCAGTCCCTATTAA pLKO_005 612 CDS 100% 15.000 10.500 N HTR2B n/a
3 TRCN0000014487 GCACAATTCCTGAGCACATTT pLKO.1 89 5UTR 100% 13.200 9.240 N HTR2B n/a
4 TRCN0000014483 GCAGTTGTCATCAAACATAAT pLKO.1 1509 3UTR 100% 13.200 9.240 N HTR2B n/a
5 TRCN0000368526 TATGTCCTGCCTGGTTATTTC pLKO_005 434 CDS 100% 13.200 9.240 N HTR2B n/a
6 TRCN0000014484 GCCTGGTTATTTCTTGACGTT pLKO.1 442 CDS 100% 2.640 1.848 N HTR2B n/a
7 TRCN0000014485 CCAGTCCCTATTAAAGGGATA pLKO.1 619 CDS 100% 0.405 0.284 N HTR2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001320758.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06418 pDONR223 100% 91.1% 91% None 0_1ins126;1304A>G n/a
2 ccsbBroad304_06418 pLX_304 0% 91.1% 91% V5 0_1ins126;1304A>G n/a
3 TRCN0000466805 CCTCCAACTGCAGAATGATGGACA pLX_317 23.1% 91.1% 91% V5 0_1ins126;1304A>G n/a
4 TRCN0000488770 CGCGTCGATCAGTACTCTATTATA pLX_317 21.2% 91.1% 90.8% V5 (not translated due to prior stop codon) 0_1ins126;514T>C;1304A>G n/a
5 TRCN0000489449 AGCAGTATTTACGCACTAGCTGCA pLX_317 26.6% 90.9% 90.8% V5 (many diffs) n/a
Download CSV