Transcript: Human NM_001320830.2

Homo sapiens splicing factor 3a subunit 3 (SF3A3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
SF3A3 (10946)
Length:
2615
CDS:
58..1404

Additional Resources:

NCBI RefSeq record:
NM_001320830.2
NBCI Gene record:
SF3A3 (10946)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001320830.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000218800 TAGTTAGCCATTGATGCAAAT pLKO_005 1841 3UTR 100% 10.800 8.640 N SF3A3 n/a
2 TRCN0000230056 ATAAGCTTCATGGCCTAAATA pLKO_005 1088 CDS 100% 15.000 10.500 N SF3A3 n/a
3 TRCN0000230054 CATCTGAGAAGCTGGATTATA pLKO_005 359 CDS 100% 15.000 10.500 N SF3A3 n/a
4 TRCN0000230055 TGTCCATCTTTGACCAATTAT pLKO_005 389 CDS 100% 15.000 10.500 N SF3A3 n/a
5 TRCN0000000056 CGAGACACTGAAAGGAACAAA pLKO.1 832 CDS 100% 5.625 3.938 N SF3A3 n/a
6 TRCN0000000055 TGGCCTAAATATCAACTACAA pLKO.1 1098 CDS 100% 4.950 3.465 N SF3A3 n/a
7 TRCN0000000054 CATGTTCTCCAATCCCAGGTA pLKO.1 2375 3UTR 100% 2.640 1.848 N SF3A3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001320830.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15733 pDONR223 0% 89.4% 89.4% None 144_145ins159 n/a
2 ccsbBroad304_15733 pLX_304 0% 89.4% 89.4% V5 144_145ins159 n/a
3 TRCN0000478748 TATAGAAAGCGACATAATTAGCCC pLX_317 23.1% 89.3% 89.2% V5 144_145ins159;1082A>G n/a
4 ccsbBroadEn_07712 pDONR223 100% 89.2% 89.2% None 144_145ins159;240A>G;1336G>C n/a
5 ccsbBroad304_07712 pLX_304 0% 89.2% 89.2% V5 144_145ins159;240A>G;1336G>C n/a
6 TRCN0000469098 TCCGGTAGCTCCCGCCCTCTCACC pLX_317 32.3% 89.2% 89.2% V5 144_145ins159;240A>G;1336G>C n/a
Download CSV