Transcript: Human NM_001321276.2

Homo sapiens neuroligin 3 (NLGN3), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-09
Taxon:
Homo sapiens (human)
Gene:
NLGN3 (54413)
Length:
3402
CDS:
163..2298

Additional Resources:

NCBI RefSeq record:
NM_001321276.2
NBCI Gene record:
NLGN3 (54413)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001321276.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000438123 GGCGAGGACTTAGCGGATAAT pLKO_005 289 CDS 100% 13.200 18.480 N NLGN3 n/a
2 TRCN0000436445 TCCAGACTTGGGAGCTTTAAA pLKO_005 2693 3UTR 100% 15.000 10.500 N NLGN3 n/a
3 TRCN0000417189 ACCAAGGGTCCGAGATCATTA pLKO_005 1578 CDS 100% 13.200 9.240 N NLGN3 n/a
4 TRCN0000047085 CGTGACTACTCCACTGAATTA pLKO.1 1855 CDS 100% 13.200 9.240 N NLGN3 n/a
5 TRCN0000047083 GCAGACAAAGTGGGCTGTAAT pLKO.1 754 CDS 100% 13.200 9.240 N NLGN3 n/a
6 TRCN0000438709 GCAGATGAGTCCTCGGTAAAC pLKO_005 2535 3UTR 100% 10.800 7.560 N NLGN3 n/a
7 TRCN0000047084 CGCCAGTTATGGCAATGTCAT pLKO.1 423 CDS 100% 4.950 3.465 N NLGN3 n/a
8 TRCN0000047087 CCTCTACTACCGTAAGGACAA pLKO.1 1935 CDS 100% 4.050 2.835 N NLGN3 n/a
9 TRCN0000031941 GTGGACAATCTGTATGGCTAT pLKO.1 1060 CDS 100% 4.050 2.430 N Nlgn3 n/a
10 TRCN0000031939 CCACTGAATTAAGTGTCACTA pLKO.1 1865 CDS 100% 4.950 2.970 N Nlgn3 n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2359 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001321276.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08371 pDONR223 100% 85.6% 85.5% None (many diffs) n/a
2 ccsbBroad304_08371 pLX_304 0% 85.6% 85.5% V5 (many diffs) n/a
3 TRCN0000478917 ATAACAACAGCAGAAGTCTCTGCG pLX_317 12.4% 85.6% 85.5% V5 (many diffs) n/a
Download CSV