Transcript: Human NM_001321328.2

Homo sapiens ADP ribosylation factor like GTPase 13B (ARL13B), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
ARL13B (200894)
Length:
4093
CDS:
437..1678

Additional Resources:

NCBI RefSeq record:
NM_001321328.2
NBCI Gene record:
ARL13B (200894)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001321328.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229360 ACCGGGTAGAACCACTTAATA pLKO_005 1461 CDS 100% 15.000 21.000 N ARL13B n/a
2 TRCN0000064951 CCGGGTAGAACCACTTAATAT pLKO.1 1462 CDS 100% 15.000 21.000 N ARL13B n/a
3 TRCN0000229359 GATATCGGGAAAGCCTATATT pLKO_005 748 CDS 100% 15.000 21.000 N ARL13B n/a
4 TRCN0000064948 CCTTAAATGAACGCATCCAAA pLKO.1 978 CDS 100% 4.950 6.930 N ARL13B n/a
5 TRCN0000218563 GGCATTAACACAGCAGTTAAA pLKO_005 1357 CDS 100% 1.320 1.848 N ARL13B n/a
6 TRCN0000064952 CCTATATTGGTGTTGGCAAAT pLKO.1 761 CDS 100% 10.800 8.640 N ARL13B n/a
7 TRCN0000229361 CATCGTAATTTGACCTAATTT pLKO_005 2312 3UTR 100% 15.000 10.500 N ARL13B n/a
8 TRCN0000064950 CCAGCCAATAGCATCTGTAAT pLKO.1 1162 CDS 100% 13.200 9.240 N ARL13B n/a
9 TRCN0000218877 CATCATTGGAATCAGCTAATG pLKO_005 1401 CDS 100% 10.800 7.560 N ARL13B n/a
10 TRCN0000064949 CCTGTCAGAAAGGTGACTCTT pLKO.1 321 5UTR 100% 4.950 3.465 N ARL13B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001321328.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05195 pDONR223 100% 92.1% 91.2% None (many diffs) n/a
2 ccsbBroad304_05195 pLX_304 0% 92.1% 91.2% V5 (many diffs) n/a
3 TRCN0000471890 TCAGTCACTACGGACACAAGATGA pLX_317 31.9% 92.1% 91.2% V5 (many diffs) n/a
Download CSV