Transcript: Human NM_001321905.2

Homo sapiens dipeptidyl peptidase like 10 (DPP10), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
DPP10 (57628)
Length:
6360
CDS:
512..2953

Additional Resources:

NCBI RefSeq record:
NM_001321905.2
NBCI Gene record:
DPP10 (57628)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001321905.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046663 CGGTGGATCAATGATACAGAT pLKO.1 821 CDS 100% 4.950 6.930 N DPP10 n/a
2 TRCN0000046666 GCAGGAGATTCATCGAAGATT pLKO.1 2398 CDS 100% 5.625 3.938 N DPP10 n/a
3 TRCN0000046665 GCATACGATGAAACTACTCAA pLKO.1 1850 CDS 100% 4.950 3.465 N DPP10 n/a
4 TRCN0000046667 GCTACCACATTATTATTGGAA pLKO.1 896 CDS 100% 3.000 2.100 N DPP10 n/a
5 TRCN0000046664 GCAGCCAGTGTGCTACATAAT pLKO.1 2672 CDS 100% 13.200 7.920 N DPP10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001321905.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08751 pDONR223 100% 96.3% 96% None (many diffs) n/a
2 ccsbBroad304_08751 pLX_304 0% 96.3% 96% V5 (many diffs) n/a
3 TRCN0000471905 ACTCCTGGGACCGGACATAAATCA pLX_317 1.4% 96.3% 96% V5 (many diffs) n/a
Download CSV