Transcript: Human NM_001322251.2

Homo sapiens musashi RNA binding protein 2 (MSI2), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
MSI2 (124540)
Length:
2340
CDS:
221..988

Additional Resources:

NCBI RefSeq record:
NM_001322251.2
NBCI Gene record:
MSI2 (124540)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001322251.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432136 TTACACCATGGACGCGTTCAT pLKO_005 832 CDS 100% 4.950 6.930 N MSI2 n/a
2 TRCN0000062812 AGATAGCCTTAGAGACTATTT pLKO.1 322 CDS 100% 13.200 9.240 N MSI2 n/a
3 TRCN0000062809 GTGGAAGATGTAAAGCAATAT pLKO.1 587 CDS 100% 13.200 9.240 N MSI2 n/a
4 TRCN0000417428 TGCAATGCTGATGTTTGATAA pLKO_005 634 CDS 100% 13.200 9.240 N MSI2 n/a
5 TRCN0000062808 CCAGCAAGTGTAGATAAAGTA pLKO.1 434 CDS 100% 5.625 3.938 N MSI2 n/a
6 TRCN0000071977 CCACCATGAGTTAGATTCCAA pLKO.1 466 CDS 100% 3.000 2.100 N Msi2 n/a
7 TRCN0000324687 CCACCATGAGTTAGATTCCAA pLKO_005 466 CDS 100% 3.000 2.100 N Msi2 n/a
8 TRCN0000062811 CCCAACTTCGTGGCGACCTAT pLKO.1 878 CDS 100% 1.650 1.155 N MSI2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001322251.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09483 pDONR223 100% 73.7% 74.3% None (many diffs) n/a
2 ccsbBroad304_09483 pLX_304 0% 73.7% 74.3% V5 (many diffs) n/a
3 TRCN0000465338 GATCTCGCCGAGCCAAACTTGCCT pLX_317 29.5% 73.7% 74.3% V5 (many diffs) n/a
4 ccsbBroadEn_13107 pDONR223 100% 59.2% 59.2% None 1_312del n/a
5 ccsbBroad304_13107 pLX_304 0% 59.2% 59.2% V5 1_312del n/a
6 TRCN0000468295 CTGACGCTGTAATCCCGACCACGA pLX_317 77.8% 59.2% 59.2% V5 1_312del n/a
Download CSV